B12A-Evolve-A1.txt

Graham L. Kendall
Modified 8/19/2008
Email grahamkendall74135@yahoo.com
I am found on IRC Efnet/Undernet/Dalnet as glk
Files on science and religion are found at
http://www.grahamkendall.net/
All are free to use any of this material without limit.
Linking to this url is allowed.
*******************************************************************************
=======
UMd-Led Team Discovers Gene Mutation for Milk Tolerance in Africans
A discovery by an international team led by University of Maryland researcher
Sarah Tishkoff identifies, for the first time, genetic mutations in East
Africans that are associated with the ability to digest milk as adults.
Tishkoff's study of DNA, described in next week's online issue of the journal
Nature Genetics , found that the mutations evolved at the time in history when
some Africans were beginning to raise cattle, and they evolved independently
from the mutation that regulates milk digestion in Europeans.
The findings are not only evidence of how genes and culture co-evolve, says
Tishkoff, associate professor of biology at Maryland, "they reveal one of the
most striking genetic footprints of natural selection ever observed in humans."
Lactose Intolerant Humans
Human adults were not designed to digest milk. It took a genetic mutation to
enable humans to tolerate lactose, the main sugar found in milk. But not
everyone has the mutation. Most northern Europeans, whose ancestors
domesticated cattle, do. Descendants of cultures that did not raise cattle for
milk -- many southern Europeans, most Asians and many Africans -- do not have
the mutation and can't digest milk products.
Then there is the mystery of why some African people who raise cattle and
successfully digest milk do not have the mutation that allows Europeans to
digest milk.
Tishkoff's study appears to have solved that mystery. By resequencing DNA
samples that her team collected from a number of different ethnic groups in
remote regions of Africa and testing whether genetic variation is associated
with the ability to digest lactose, Tishkoff discovered that, indeed, a
distinct genetic mutation to allow digestion of milk occurred in Africa
independently from the European mutation and arose at the time that African
populations started raising cattle.
The mutation has gone undetected until now because it appears to be in a
different location than the European mutation, and appears to be restricted to
East African populations that herd cattle.
Got Milk?
Tishkoff research team field assistant uses a glucose monitor to test for
blood sugar levels of volunteers
When humans were hunter-gatherers, before some began to domesticate cattle,
they were able to digest milk only until they were about four years old.
Lactase-phlorizin hydrolase (LPH), the enzyme that lets humans digest lactose,
the main carbohydrate in milk, works in the small intestine to help the body
absorb the sugars found in lactose. But LPH levels decrease rapidly after
weaning and are at low levels in adults
When milk became a human food source, evolution went to work. Says Tishkoff,
"The ability to digest milk as adults, called lactase persistence, appears to
be an excellent example of gene-culture co-evolution. In this case, it is the
development of technology -- raising cattle -- and the genetic mutation -- the
ability to digest milk -- that becomes common."
By looking at the rate of decay of association of genetic variants over a
three-million base pair region, Tishkoff and collaborators were able to
estimate when these genetic mutations occurred in human history. The mutation
for lactose tolerance began to show up in Northern Europeans at about the same
time they began to raise milk cattle, around 9,000 years ago. A distinct
mutation for lactose tolerance became common in East Africa beginning around
7,000 years ago. These dates correlate with archeological evidence for the
origins of cattle domestication in these regions.
Got Genes?
For Tishkoff, who has been doing genetics research on disease and human
origins among African populations for more than ten years, there were clues
that some groups of Africans had adapted due to a distinct genetic mutation
for lactase persistence-- they have a history of cattle domestication, they
consume milk-- yet they don't have the mutation associated with lactase
persistence in Europeans.
"Archeological evidence suggests that cattle domestication originated in
southern Egypt as early as 9,000 years ago," said Tishkoff. "The ability to
digest milk as adults was likely to be adaptive, because of the nutritional
benefits from milk, and also because milk is an important source of water in
arid regions. During the dry season, many pastoralist populations are fully
milk-dependent."
Tishkoff's group selected specific African ethnic groups to study, those with
and without a history of cattle domestication. Driving across rugged terrain
in Land Cruisers, traveling to remote villages, and setting up collection
stations under trees, they collected DNA samples from almost every major
pastoralist population and some hunter-gatherers in regions where no one else
had looked before: the Arusha and Dodoma provinces of Tanzania; Rift Valley,
Eastern, and Nyanza provinces of Kenya; and the Khartoum and Kasala provinces
of the Sudan.
The researchers also asked volunteers to consume lactose, then measured their
blood sugar levels to determine if they were able to digest the lactose found
in milk. "This ability was then compared to the specific genetic variants
found in these individuals to identify the genetic basis for the ability to
digest milk," says Tishkoff.
Former Maryland graduate student Kweli Powell prepares the lactose solution
for the blood sugar test. The Tishkoff team collected DNA samples from a
number of remote areas of Africa.
Location, Location, Location
Five hundred field samples of DNA went to Dr. Panos Deloukas' lab at the
Sanger Institute in Cambridge, England, for genotyping of the new African
variants identified by the Tishkoff lab. The lab also did genotyping of 123
genetic differences over a three-million-base pair region of chromosome 2,
which encompasses the gene that regulates lactose digestion.
It was on that chromosome, near the gene coding for the enzyme"lactase" that
the genetic variations for milk digestion in the African populations turned up
-- not just one, but three distinct mutations that evolved at different times,
in different geographic regions. The most significant variant, the C-14010
allele, was common in East Africans. Two other mutations, not as common, were
G-13907 and G-13915, found among Beja (North Sudan) and North Kenyan
populations.
Studies of gene expression in small intestine cell lines that contained these
new mutations, led by Dr. Greg Wray at Duke University in collaboration with
the Tishkoff study, also indicated that these mutations regulate expression of
the enzyme "lactase," that enables digestion of lactose.
Based on computer simulations of the strength and age of selection, done in
collaboration with Dr. Jonathan Pritchard and Benjamin Voight at the
University of Chicago, they estimate the most common mutation, C-14010,
evolved over a 7,000-year time span, when different groups of Africans were
moving from being hunter-gatherer to pastoral cultures.
"If a mutation provides a strong benefit, it will become common in the
population," says Tishkoff. "This mutation was so important for adaptation
that it rapidly swept to high frequency in East Africa.
"Furthermore, positive selection was so strong that a huge region of
chromosome 2 near this mutation rapidly swept to high frequency as well,"
Tishkoff said. "The area of the chromosome affected by this adaptive event,
more than two million nucleotides, is larger then any region ever reported in
any human population, making this one of the most striking examples of recent
natural selection in humans."
Implications for Disease
"Without resequencing, we wouldn't have found this," said Tishkoff. "Our
results point to the importance of studying genetic variation in different
ethnic groups. Even though we weren't looking for disease mutations, it
demonstrates that mutations, including those that result in disease, can be
geographically restricted."
Other University of Maryland researchers involved with this study include NIH
postdoctoral research fellow Floyd Reed and graduate students Alessia
Ranciaro, Holly Mortensen, Kweli Powell and Jibril B. Hirbo.
Collaborating institutions were the Institute for Genome Sciences and Policy,
Duke University; Department of Human Genetics, University of Chicago;
Department of Biology, University of Ferrara, Italy; Institute of Endemic
Diseases, University of Khartoum, Sudan; Kenya Medical Research Institute,
Nairobi, Kenya; Department of Biochemistry, Muhimbili University College of
Health Sciences, Dar es Salaam, Tanzania; and the Wellcome Trust Sanger
Institute, Hinxton, UK.
The research was funded by grants to Tishkoff and collaborators from the
L.S.B. Leakey and Wenner Gren Foundation, the National Science Foundation, the
National Institutes of Health, and the David and Lucile Packard and Burroughs
Wellcome Foundations, the Wellcome Trust, and The Institute for Genome
Sciences & Policy of Duke University.
==
http://chem.tufts.edu/science/evolution/horseevolution.htm   
==
There is strong genetic and anatomical evidence in favour of an evolutionary 
connection between the proteroglyph elapids and the solenoglyph viperids and 
colubroid snakes. These are all crown group snakes.
Hieroglyphic snakes include both cobras, grass snakes and horned 
vipers, which would make Hieroglypha synonymous with Colubroidea, i.e. all 
crown group snakes.
==
Giant Prehistoric "Kangaroos" Killed Off by Humans
Humans, not climate change, were responsible for the extinction of giant
"kangaroos" and other massive marsupials in Tasmania more than 40,000 years
ago, according to new research.
Hunting on the Australian island exterminated several prehistoric animals,
including the kangaroo-like beasts, marsupial "hippopotamuses," and
leopard-like cats, a team of scientists announced. (Learn more about the red
kangaroos and hippos of today.)
The giant kangaroo-like Protemnon anak, a long-necked leaf browser, survived
on Tasmania until at least 41,000 years agomuch later than previously believed
and up to 2,000 years after the first human settlers are believed to have
arrivedaccording to new radiocarbon and luminescence dating of fossils, some
of which were accidentally found by cavers.
Previous studies had concluded that Tasmania's giant beasts had already
disappeared by the time humans crossed a temporary land bridge to the island
43,000 years ago. These studies blamed the extinctions on climate
changeincluding the last ice ageinstead.
The new findings appear this week in the journal Proceedings of the National
Academy of Sciences.
Marsupial Menagerie
Six other giant prehistoric Tasmanian species survived the climate change of
the time and likely existed until the arrival of humans, although the animals'
remains were not specifically dated to the time humans are believed to have
been on the island, according to the study.
The other species include "three kangaroos that would have been in the
220-pound (100-kilogram) size range," said team member Tim Flannery of
Australia's Macquarie University.
"There was a marsupial leopard, which was probably 100 to 220 pounds [50 to
100 kilograms] in weight," he said.
"There was also what I would call a marsupial ground sloth that weighed
several hundred kilograms at least, and perhaps in excess of 1,000 pounds (500
kilogram).
"And then a thing that you might want to call a marsupial hippopotamus, or a
marsupial tapir, which would have weighed about 1,000 pounds (500 kilograms)."
Studies have found that Tasmania and present-day Victoria state, on the nearby
Australian mainland, shared a similar climate back then, Flannery said
About 90 percent of mainland Australian megafauna disappeared about 46,000
years ago, soon after humans first settled the continent, studies have found.
Flannery said these extinctions were mirrored in Tasmania 3,000 years later,
when the "Bass Strait dried up and a land bridge formed between Victoria and
Tasmania, allowing [people] in."
Extinctions of large animals were "one of the key signatures, if you like, of
the arrival of humans," he said, naming other places the phenomenon likely
occurred.
"In the Americas 13,000 years ago, the same thing happened. In Madagascar
2,000 years ago, the same thing. New Zealand 1,000 years ago, the same thing."
On Caribbean islands, he said, "giant sloths survived for about another 6,000
or 8,000 years after their extinction date on the mainland. Why? Because
people hadn't gotten to those islands. Now we are seeing the same thing with
Tasmania."
Easy Prey
Evidence points to a rapid extermination that may have occurred within a
thousand years, Flannery said.
"We have no evidence of any sort of specialized hunting technology at all.
It's quite likely that these things didn't recognize humans as a threat, so
perhaps a wooden spear or a club was enough to kill them."
Gavin Prideaux, a paleontologist at Flinders University in Australia, said
that, while Aboriginal people weren't known to have used stone spear tips
until around 5,000 to 6,000 years ago, they used fire to toughen several
species of Australian hardwoods to make formidable spears.
"This is a first major step towards understanding what happened in Tasmania,"
Prideaux said.
However, only the giant, kangaroo-like Protemnon has been shown conclusively
to have co-existed with people, he said.
"There may very well be others, but at the moment, that's where it stands."
Prideaux added that many more megafauna fossils are likely to be found on
Tasmania, "because there has been so little exploration. We need to find
those, get them dated, and build up a picture."
==
Optimism in Evolution

When the dog days of summer come to an end, one thing we can be sure
of is that the school year that follows will see more fights over the
teaching of evolution and whether intelligent design, or even Biblical
accounts of creation, have a place in America's science classrooms.

In these arguments, evolution is treated as an abstract subject that
deals with the age of the earth or how fish first flopped onto land.
It's discussed as though it were an optional, quaint and largely
irrelevant part of biology. And a common consequence of the arguments
is that evolution gets dropped from the curriculum entirely.

This is a travesty.

It is also dangerous.

Evolution should be taught a indeed, it should be central to beginning
biology classes a for at least three reasons.

First, it provides a powerful framework for investigating the world we
live in. Without evolution, biology is merely a collection of
disconnected facts, a set of descriptions. The astonishing variety of
nature, from the tree shrew that guzzles vast quantities of alcohol
every night to the lichens that grow in the Antarctic wastes, cannot
be probed and understood. Add evolution a and it becomes possible to
make inferences and predictions and (sometimes) to do experiments to
test those predictions. All of a sudden patterns emerge everywhere,
and apparently trivial details become interesting.

The second reason for teaching evolution is that the subject is
immediately relevant here and now. The impact we are having on the
planet is causing other organisms to evolve a and fast. And I'm not
talking just about the obvious examples: widespread resistance to
pesticides among insects; the evolution of drug resistance in the
agents of disease, from malaria to tuberculosis; the possibility that,
say, the virus that causes bird flu will evolve into a form that
spreads easily from person to person. The impact we are having is much
broader.

For instance, we are causing animals to evolve just by hunting them.
The North Atlantic cod fishery has caused the evolution of cod that
mature smaller and younger than they did 40 years ago. Fishing for
grayling in Norwegian lakes has caused a similar pattern in these
fish. Human trophy hunting for bighorn rams has caused the population
to evolve into one of smaller-horn rams. (All of which, incidentally,
is in line with evolutionary predictions. )

Conversely, hunting animals to extinction may cause evolution in their
former prey species. Experiments on guppies have shown that, without
predators, these fish evolve more brightly colored scales, mature
later, bunch together in shoals less and lose their ability to
suddenly swim away from something. Such changes can happen in fewer
than five generations. If you then reintroduce some predators, the
population typically goes extinct.

Thus, a failure to consider the evolution of other species may result
in a failure of our efforts to preserve them. And, perhaps, to
preserve ourselves from diseases, pests and food shortages. In short,
evolution is far from being a remote and abstract subject. A failure
to teach it may leave us unprepared for the challenges ahead.

The third reason to teach evolution is more philosophical. It concerns
the development of an attitude toward evidence. In his book, "The
Republican War on Science," the journalist Chris Mooney argues
persuasively that a contempt for scientific evidence a or indeed,
evidence of any kind a has permeated the Bush administration' s
policies, from climate change to sex education, from drilling for oil
to the war in Iraq. A dismissal of evolution is an integral part of
this general attitude.

Moreover, since the science classroom is where a contempt for evidence
is often first encountered, it is also arguably where it first begins
to be cultivated. A society where ideology is a substitute for
evidence can go badly awry. (This is not to suggest that science is
never distorted by the ideological left; it sometimes is, and the
results are no better.)

But for me, the most important thing about studying evolution is
something less tangible. It's that the endeavor contains a profound
optimism. It means that when we encounter something in nature that is
complicated or mysterious, such as the flagellum of a bacteria or the
light made by a firefly, we don't have to shrug our shoulders in
bewilderment.

Instead, we can ask how it got to be that way. And if at first it
seems so complicated that the evolutionary steps are hard to work out,
we have an invitation to imagine, to play, to experiment and explore.
To my mind, this only enhances the wonder.
==
Stones & Bones (Hardcover) by Char Matejovsky (Author), 
Robaire Ream (Illustrator) 
==
Comb jellyfish are near the base of the multicell life tree.
==
http://en.wikipedia.org/wiki/Amphisbaenia
==
Ancient "devil frog" may have eaten baby dinosaurs
WASHINGTON (Reuters) - It was the biggest, baddest, meanest froggy ever to
have hopped on Earth.
Scientists on Monday announced the discovery in northwestern Madagascar of a
bulky amphibian dubbed the "devil frog" that lived 65 million to 70 million
years ago and was so nasty it may have eaten newborn dinosaurs.
This brute was larger than any frog living today and may be the biggest frog
ever to have existed, according to paleontologist David Krause of Stony Brook
University in Stony Brook, New York, one of the scientists who found the
remains.
Its name, Beelzebufo ampinga, came from Beelzebub, the Greek for devil, and
bufo -- Latin for toad. Ampinga means "shield," named for an armor-like part
of its anatomy.
Beelzebufo (pronounced bee-el-zeh-BOOF- oh) was 16 inches
long and weighed an estimated 10 pounds (4.5 kg).
It was powerfully built and possessed a very wide mouth and powerful jaws. It
probably didn't dine daintily.
"It's not outside the realm of possibility that Beelzebufo took down lizards
and mammals and smaller frogs, and even -- considering its size -- possibly
hatchling dinosaurs," Krause said in a telephone interview.
"It would have been quite mean," added paleontologist Susan Evans of
University College London, another of the scientists.
Their findings were published in the journal Proceedings of the National
Academy of Sciences.
Even though it lived far away, Beelzebufo appears to be closely related to a
group of frogs that live today in South America, the scientists said. They are
nicknamed "Pac-Man" frogs due to their huge mouths. Some have little horns on
their heads, and the scientists think Beelzebufo also may have had horns -- a
fitting touch for the "devil frog."
Beelzebufo was bigger than any of its South American kin or any other living
frog -- "as if it was on steroids," Krause said. The largest one today is the
goliath frog of West Africa, up to 12.5 inches long and 7.2 pounds (3.3 kg).
The presence of Beelzebufo in Madagascar and its modern relatives in South
America is the latest sign a long-lost land bridge once may have linked
Madagascar to Antarctica -- much warmer then -- and South America, the
scientists said.
That would have let animals move overland among those land masses. Fossils
have been found of other animals in Madagascar from Beelzebufo's time similar
to South American ones.
KING OF FROGS
The first frogs appeared about 180 million years ago, and their basic body
plan has remained unchanged. Beelzebufo lived during the Cretaceous Period at
the end of the age of dinosaurs, which went extinct along with many other
types of animals 65 million years ago when a huge space rock clobbered Earth.
Beelzebufo did not live an aquatic lifestyle, hopping among lily pads, the
scientists said. Instead, it lived in a semi-arid environment and may have
hunted like its modern-day relatives, which camouflage themselves and jump out
at prey.
Its first fragmentary fossils were found in 1993, and the scientists have
since assembled enough fragments to piece its remains together like a jigsaw
puzzle, Krause said.
While it was the king of frogs, Beelzebufo is not the largest amphibian ever
to have lived. Many reached truly astounding dimensions, such as the
crocodile-like Prionosuchus that grew to an estimated 30 feet during the
Permian Period, which ended about 250 million years ago.
==
Random mutation. You want some examples?
Chimps have a thick covering of fur. You don't. Do yo uknow why?
You actually have the chimpanzee fur gene in your body. it doesn't
work. Why? It has a transposon in it. A transposon is a genetic
disease, a bit of self-replicating DNA that copies itself and splices
itself through your genes. This disease organism is all that's
stopping YOU from having a fur coat.
Why do you have a deactivated chimpanzee fur gene in you.
Here's an interesting gene you share with chimps: A vitamin C gene.
You and the chimps have the same gene broken in exactly the same
fashion. Why?
===
Archaeopteryx
Feathers: Considered diagnostic among birds, but increasingly found
on clear-dinosaurs.
Opposable big toe: Like birds, not like most dinosaurs.
Wishbone: Birds have them, dinosaurs don't. Archaeopteryx is
dinosaur like... mostly. Actually, it looks like it has a
transitional state, inbetween the fused wishbone/normal clavicle.
Almost like it's a transition or something.
Elongated pubis: A feature found in all birds. Also found in
dinosaurs. Hey, you think they may be related?
Beaks: Theropod dinosaurs don't have beaks. Birds do. Archy has no
beak, dinosaur-like!
Trunk vertebrae: Dinosaurs have them unfused. Birds have them fused.
Archy is dinosaur-like.
Pneumatic bones: Dinosaurs have largely non-pneumatic bones. Birds
have highly pneumatic bones. Archy... is in between. Hey, transitional!

I could go on for some time, but you can read them here:
http://www.talkorig ins.org/faqs/ archaeopteryx/ info.html# features

The lesson is obvious: Archaeopteryx is a complex mixture of
typically-dinosaur features and typically-bird features. Almost like
it is a transition between the two. Claiming it only has bird
features if flatly false, since the only other birds you can point to
with those features are nearly dinosaurs!
Unlike modern feathers, archy's feathers are almost
symmetrical and quite primitive.
It's wings are quite arm-like, not like modern wings.
Dinosaur and birds are nearly identical in these
features anyway. And, not really when you get to the details.
It's beak, it's neck, it's skull sutures, it's arm-claws, it's bones,
it's brain shape, it's long-bony tail (name one bird with a long tail
made of bone, please)... in fact, by any objective meausre, it is far
more dinosaur like than bird-like. The only things it has that are
especially bird like are its feet and feathers. It's other bird
traits are all, *all* only partially formed (like the wishbone).
It is far more a dinosaur than a bird. Read for yourself.
Oh, do let us know how you judge it's genetic similarity.
Ah, so you're an expert in genetics? What biochemical facts prevent
such a creature? What gene sequences cause problems?
Theropod dinosaurs already had avian lungs and organ placements.
==
Tiny Pterodactyl Fossil Found
A pterodactyl so small that you could hold it in your hand glided in forest
canopies in northeastern China where it feasted on insects 120 million years
ago, new fossil remains suggest.
Paleontologists discovered the nearly complete skeleton ofa
toothlessmini-pterodactyl, called Nemicolopterus crypticus, in the western
part of China's Liaoning Province.
With a wingspan of nearly 10 inches (25 centimeters), this half-pint
represents the smallest pterosaur, a group of winged reptiles that shared a
common ancestor with dinosaurs and ruled the skies during the Jurassic period
(206 million to 144 million years ago) and the subsequent Cretaceous period,
which ended 65 million years ago.
"The animal is a very young animal, but it's not a hatchling that just left
the egg," said researcher Alexander Kellner of the Department of Geology and
Paleontology at the Museu Nacional/Universidade Federal do Rio de Janeiro.
"Therefore it is the smallest pterosaur ever found."
Unlike its fish-eating relatives that lived near the water's edge,
Nemicolopterus sported curved digits on its feet that would have helped the
animal grasp tree branches. At that time, the researchers say, this inland
environment was covered with gingko, conifers and other trees. The pterosaur's
small size would also have helped it bound across the tree canopy, grabbing
insects.
Its position in the evolutionary tree of pterosaurs suggests that a lineage of
Nemicolopterus-like creatures led to all of the giant pterosaurs, including
Quetzalcoatlus, which boasted a wingspan of more than 30 feet (10 meters).
"The general idea was at some point we had these very primitive pterosaurs 
very low down on the evolutionary tree  that were living on insects," Kellner
told LiveScience. "At some point pterosaurs learned to feed on fish."
He added that the finding, detailed in the Feb. 12 issue of the Proceedings of
the National Academy of Sciences, represents a new group of pterosaurs that
could shed light on the evolution of all these flying reptiles.
==
http://www.talkorigins.org/faqs/faq-transitional.html
==
The Archaeopteryx  wing is fully formed, but it retains three clawed 
fingers typical of theropod dinosaurs. Apart from a little longer fingers 
the wing of Archaeopteryx looks _exactly_ like the arms of deinonychosaurian 
theropods (velociraptors, troodonts, microraptors) . By the way, we know that 
deinonychosaurs were feathered and had arms that looked like wings. Like in 
birds the long primaries were placed on the middle finger.
Bird and theropod feet and legs are basically identical. To 
this day birds have dinosaur type legs.
Archaeopteryx didn't have a beak, it probably had scaly 
lips. However, your point with the mouth is that Archaeopteryx had teeth. 
Incidentally teeth identical to the teeth of baby deinonychosaurs. We know 
that other early birds also had teeth (Hesperprnis, Ichtyornis, etc), so it 
is true that dinosaur type teeth were part of the variation of birds. Living 
birds still have the ability to produce that type of teeth if the jaws of 
the fetus is injected with fluids from the jaw of a mammal fetus.
It would have been able to glide very well, however. The fossils show us a 
number of small gliding dinosaurs. There is a very nice series of 
transitionsal forms documented from the fossil record.
And as a dinosaur researcher said more than a decade ago: half a wing could 
have been a complete something else. Half a wing -long feathers and all, 
exactly like the arms of many theropods, is perfect for brooding. Dinosaurs 
have been found in the typical birdlike brooding posture on top of their 
nests. (Buried alive while trying to shelter the eggs during sandstorms.)
The bone structure of Archaeopteryx is identical to a theropod 
dinosaur. When Archaeopteryx was discovered it was mistaken for a small 
dinosaur, Compsognathus, to be precise.
Lungs and internal organs of dinosaurs, even the big longnecked 
sauropods, were birdlike. There is fossil evidence.
New and more complex "kinds" of animals appear in sediments above 
the simpler ones...
==
Some early birds also had teeth (Hesperprnis, Ichtyornis
==
After a few generations, species will be well adapted
to their environments. Once a polar bear is white, any subsequent
change to it's fur color is a bad idea. That is, once you are well
adapted, any further change is a bad one and all mutations become
harmful. It's only when the environment changes or when the animal
moves into a new environment that there's any likelihood of beneficial
change.
In order for there to be a beneficial mutation, you must be maladapted
currently in some way. if you're well adapted, most changes will be
bad changes.
The creationist mistake, then, is taking stable species, checking the
mutation rates, and saying, "I don't see any beneficial changes,
they're all still cows, we're done, evilution is a lie!"
Now, look at places where the environment changes and you can see
evolution in action. Rattles on snakes were a good idea, until humans
arrived with snake killing technology. Now, each generation of
rattler favors more stealthy tactics than the last. Elephants reduce
their tusks to become less attractive to poochers, tigers are adapting
their hunt to avoid human technology.. . examples are numerous.
==
In January 1955, Homer Jacobson, a chemistry professor at Brooklyn College,
published a paper called aInformation, Reproduction and the Origin of Lifea in
American Scientist, the journal of Sigma Xi, the scientific honor society.
==
The dean of American biology, Theodosius Dobzhansky (1900-1975), claimed that
³evolution² is the cornerstone of biology and is central to understanding both
living and extinct organisms (1973).  His statement that ³nothing in biology
makes sense except in the light of evolution² has been repeated in thousands of articles in order to argue that Darwinism must have a central place in all
areas of science education, including medicine, agriculture and biotechnology.
==
Chatty Cave Men? Me Neanderthal, Talk Good
Neanderthals are humanity's closest extinct relatives. Since their discovery
more than 150 years ago, researchers have found out they could make tools just
like our ancestors could, but whether Neanderthals also had advanced language,
rather than mere grunts and groans, has remained hotly debated.
To learn more, scientists investigated DNA from Neanderthal bones collected
from a cave in northern Spain, concentrating on a gene, FOXP2, which is to
date the only one known to play a role in speech and language. People with an
abnormal copy of this gene have speech and language problems.
Genes similar to FOXP2 are found throughout the genomes of the animal kingdom,
from fish to alligators to songbirds. The molecule that human FOXP2 generates
differs from chimpanzee FOXP2's by just two amino acids, the building blocks
of proteins.
Past research suggests the gene's modern human variant evolved fewer than
200,000 years ago. Now scientists find the Neanderthal FOXP2 gene is identical
to ours. The ancestors of Neanderthals diverged from ours roughly 300,000 years
ago, according to the latest thinking. Some studies have suggested that the two
species might have intermingled after that, however.
"It is possible that Neanderthals spoke just like we do," paleogeneticist
Johannes Krause of the Max Planck Institute for Evolutionary Anthropology in
Leipzig, Germany, told LiveScience.
"Of course many genes are involved in language," cautioned Krause, the new
study's lead researcher. As scientists discover more of such genes, these will
have to be examined in Neanderthals as well, he said.
Krause noted that some might suggest that interbreeding or "gene flow" (aka
sex) between modern humans and Neanderthals led to us having FOXP2 in common.
"However, we see no evidence for gene flow in the Y chromosome sequences," he
said. Instead, the modern human and Neanderthal Y chromosomes are
substantially different genetically.
==
Sexy Corals Keep Eye on Moon, Scientists Say
Birds do it. Bees do it. Even lowly corals do it but infrequently, forgoing
sex for as long as a year.
Then, at night, just after the full moon, under warm tropic breezes, the
corals dissolve in an orgy of reproduction, sowing waters with trillions of
eggs and sperm that swirl and dance and merge to form new life. The frenzy can
leave pink flotsam.
Scientists discovered the mysterious rite of procreation in 1981 and ever
since have puzzled over its details. The moon clearly rules the synchronized
mass spawning, which happens during different months in different parts of the
globe, but usually in the summer. But how do corals monitor the moons phases
and know when to start mingling?
Today, seven scientists from Australia, Israel and the United States report in
the journal Science that corals have primitive photoreceptors, if not true
eyes. In experiments, they found that the photosensitive chemicals respond to
moonlight as admirably as, well, human lovers.
This looks to be the smoking gun, Ove Hoegh-Guldberg, a team member at the
University of Queensland, said in an interview. It triggers the largest
spawning event on the planet.
Margaret W. Miller, a coral specialist at the National Oceanic and Atmospheric
Administration, called the finding by the group of scientists a big step
forward. Its always been a mystery as to how these animals manage to
synchronize themselves.
In recent years, the undersea love-fests have become tourist attractions for
divers in the Caribbean, in Australia on the Great Barrier Reef, and other
coral havens. Al Giddings, a famous ocean photographer, made a PBS documentary
that showed reefs around the Pacific islands of Palau exploding in blizzards of
rising sperm and eggs.
Though the scientists involved say more work is needed to determine how the
photoreceptor works, the finding is significant because it addresses the
spawnings main riddle, marine biologists say. When I talk about thousands of
reefs in the Caribbean releasing their spawn within minutes of each other
during a specific phase of the moon, people marvel and ask, How do they do it?
said Alina M. Szmant, a coral expert at the University of North Carolina,
Wilmington. My answer is always, Its a mystery.
Now, she said, the discovery provides clues to the puzzle and opens up a new
direction to explore. Biologists say the finding sheds light on hidden aspects
not only of coral reproduction but of evolution, suggesting that light
receptors arose surprisingly early in the development of animals. Corals
emerged more than 500 million years ago, near the dawn of complex life. Our
discovery, the scientists write in Science, suggests that the basic mechanisms
for responding to light were in place at the origins of multicellularity in
animals.
People have known about the moons romantic possibilities for a long time.
Shakespeare in A Midsummer Nights Dream relies on moonlight to set the mood.
The 1987 movie Moonstruck features a love story centered on La Bella Luna.
Corals are actually colonies of individual organisms called polyps, which
create the skeletal structure that binds them together. For centuries,
scientists held that corals were primitive creatures with no brain or eyes
that knew nothing of moonlight or other environmental nuances and reproduced
mainly by brooding offspring and bringing forth live young.
In 1981, that dogma began to collapse when graduate students at James Cook
University in Australia followed a trail of clues to a nighttime mass spawn on
the Great Barrier Reef. Their discovery made the cover of Science in 1984, and
a chapter of the 1998 book The Enchanted Braid (John Wiley), which called the
startling find a coup for a group of graduate students.
Investigation showed that the swirling eggs and sperm would merge and float
away, forming embryonic corals that would sink to the ocean floor and, if
conditions were right, found new colonies. Scientists speculated that the
moons phase was important in the ritual because it controlled the tides. But
in some places the tides were low and in others high, and scientists now say
the moon may simply act as a clock to choreograph sex among more than 100
species of corals.
The photoreceptor discovery is the brainchild of Oren Levy, a young Israeli
scientist who traveled to Australia in 2004 to study in Dr. Hoegh-Guldbergs
laboratory at the University of Queensland. Dr. Levy was fascinated by a class
of photoreceptors known as cryptochromes. Originally found in plants, they had
been tracked to insects and mammals, too. Dr. Levy wondered if corals might
possess them.
In an interview, he said one clue was that cryptochromes responded to blue
light. That frequency can easily penetrate seawater, so much so that reef
areas are sometimes known as blue deserts. Dr. Levy and his colleagues studied
Acropora millepora, a coral that can grow a foot across or wider and contain
thousands of the individual polyps. They found two kinds of cryptochrome
arrayed on the corals outer edges, one of which responded to the light and
dark phases of the moon.
==
Chimps More Evolved Than Humans
Since the human-chimp split about 6 million years ago, chimpanzee genes can be said to have evolved more than human genes, a new study suggests.
The results, detailed online this week in the Proceedings of the National
Academy of Sciences, contradict the conventional wisdom that humans are the
result of a high degree of genetic selection, evidenced by our relatively
large brains, cognitive abilities and bi-pedalism.
Jianzhi Zhang of the University of Michigan and his colleagues analyzed
strings of DNA from nearly 14,000 protein-coding genes shared by chimps and
humans. They looked for differences gene by gene and whether they caused
changes in the generated proteins.
Genes act as instructions that organisms use to make proteins and thus are
integral to carrying out biological functions, such as transporting oxygen to
the body¹s cells. Different versions of the same gene are called alleles.
Changes in DNA that affect the making of proteins are considered functional
changes, while silent changes do not affect the proteins. If we see an excess
of functional changes (compared to silent changes) the inference is these
functional changes occurred because they were positively selected, because
they were useful in some way to the organism, said study team member Margaret
Bakewell, also of UM.
Bakewell, Zhang and a colleague found that substantially more genes in chimps
evolved in ways that were beneficial than was the case with human genes.
The results could be due to the fact that over the long term humans have had a
smaller effective population size compared with chimps.
Although there are now many more humans than chimps, in the past, human
populations were much smaller, and may have been fragmented into even smaller
groups, Bakewell told LiveScience. So random events would play a more dominant
role than natural selection in humans.
Here is why: Under the process of natural selection, gene variants that are
beneficial get selected for and become more common in a population over time.
But genetic drift, a random process in which chance decides which alleles
survive, also occurs. In smaller populations, a fortuitous break for one or
two alleles can have a disproportionately greater impact on the overall genes
of that population compared with a larger one.
Chance events could also explain why the scientists found more gene variants
that were either neutral and had no functional impact or negative changes that
are involved in diseases
There is still much to learn, the scientists say, about human and chimp
evolution. There are possibly a lot of differences between human and chimps
that we dont know about, [perhaps] because there are differences in chimps
that nobody has studied; a lot of studies tend to focus on humans, Bakewell
said.
==
Tiny Creatures Rediscover the Joy of Sex
Tiny spider relatives have rediscovered the joy of sex, regaining the ability
to mate after their arachnid ancestors lost it, marking a reproductive first
in the annals of animal evolution.
There are 45 known species of these spider relatives, mites known as
Crotoniidae, which are roughly the size of a pin head, at 1.5 millimeters
across.
The Crotoniidae reproduce by having sex, which wouldn't be too strange except
that they are very similar physically to Camisiidae, a family of some 80 mite
species that all reproduce asexually via parthenogenesis, in which females
give birth to young without having sex with males.
Evolutionary biologist Katja Domes at the Technical University of Darmstadt in
Germany and her colleagues examined genetic sequences in two Crotoniidae
species and a diverse range of 13 other mite species. Their calculations show
the sexual Crotoniidae evolved from the asexual Camisiidae, the first known
reversal to sexuality from asexuality within the animal kingdom. (The only
other known such reversal is a plant, the mouseear hawkweed, or Hieracium
pilosella.)
The Crotoniidae and the Camisiidae are types of mites known as oribatids,
where parthenogenesis is unusually widespread, seen in nearly one-tenth of the
roughly 10,000 known oribatid species. Scientists know many parthenogenetic
oribatids produce rare, sterile males, suggesting the ability to produce
functional males was preserved but "dormant" in the Camisiidae and reactivated
in the Crotoniidae.
When it comes to why the Crotoniidae regained sexuality, Domes noted these
mites often colonize trees. Tree-dwelling oribatids are nearly all sexual,
while soil-dwelling oribatids such as Camisiidae are predominantly
parthenogenetic.
If plenty of resources are available over a long time to a species, as they
are with soil-dwelling mites, parthenogenesis seems to be favored, Domes
explained. On the other hand, an environment with fewer resources and more
enemies, such as one that tree-dwellers face, "could have caused the return to
sexual reproduction in the Crotoniidae and may also be an explanation for the
origin of sex in the first place," she told LiveScience.
"The most important implication is that contrary to general opinion, sexual
reproduction can be regained long after it is lost," evolutionary geneticist
Bill Birky at the University of Arizona told LiveScience.
"This implies that the genes required for producing males can be retained,
even when those genes are rarely if ever used to produce males," he said.
"This could be because male production is important even though it is rare, or
it could be because those genes have important functions other than male
production."
==
I am creating artificial life, declares US gene pioneer
Scientist has made synthetic chromosome
Breakthrough could combat global warming
Craig Venter, the controversial DNA researcher involved in the race to
decipher the human genetic code, has built a synthetic chromosome out of
laboratory chemicals and is poised to announce the creation of the first new
artificial life form on Earth.
The announcement, which is expected within weeks and could come as early as
Monday at the annual meeting of his scientific institute in San Diego,
California, will herald a giant leap forward in the development of designer
genomes. It is certain to provoke heated debate about the ethics of creating
new species and could unlock the door to new energy sources and techniques to
combat global warming.
Mr Venter told the Guardian he thought this landmark would be "a very
important philosophical step in the history of our species. We are going from
reading our genetic code to the ability to write it. That gives us the
hypothetical ability to do things never contemplated before".
The Guardian can reveal that a team of 20 top scientists assembled by Mr
Venter, led by the Nobel laureate Hamilton Smith, has already constructed a
synthetic chromosome, a feat of virtuoso bio-engineering never previously
achieved. Using lab-made chemicals, they have painstakingly stitched together
a chromosome that is 381 genes long and contains 580,000 base pairs of genetic
code.
The DNA sequence is based on the bacterium Mycoplasma genitalium which the
team pared down to the bare essentials needed to support life, removing a
fifth of its genetic make-up. The wholly synthetically reconstructed
chromosome, which the team have christened Mycoplasma laboratorium, has been
watermarked with inks for easy recognition.
It is then transplanted into a living bacterial cell and in the final stage of
the process it is expected to take control of the cell and in effect become a
new life form. The team of scientists has already successfully transplanted
the genome of one type of bacterium into the cell of another, effectively
changing the cell's species. Mr Venter said he was "100% confident" the same
technique would work for the artificially created chromosome.
The new life form will depend for its ability to replicate itself and
metabolise on the molecular machinery of the cell into which it has been
injected, and in that sense it will not be a wholly synthetic life form.
However, its DNA will be artificial, and it is the DNA that controls the cell
and is credited with being the building block of life.
Mr Venter said he had carried out an ethical review before completing the
experiment. "We feel that this is good science," he said. He has further
heightened the controversy surrounding his potential breakthrough by applying
for a patent for the synthetic bacterium.
Pat Mooney, director of a Canadian bioethics organisation, ETC group, said the
move was an enormous challenge to society to debate the risks involved.
"Governments, and society in general, is way behind the ball. This is a
wake-up call - what does it mean to create new life forms in a test-tube?"
He said Mr Venter was creating a "chassis on which you could build almost
anything. It could be a contribution to humanity such as new drugs or a huge
threat to humanity such as bio-weapons".
Mr Venter believes designer genomes have enormous positive potential if
properly regulated. In the long-term, he hopes they could lead to alternative
energy sources previously unthinkable. Bacteria could be created, he
speculates, that could help mop up excessive carbon dioxide, thus contributing
to the solution to global warming, or produce fuels such as butane or propane
made entirely from sugar.
"We are not afraid to take on things that are important just because they
stimulate thinking," he said. "We are dealing in big ideas. We are trying to
create a new value system for life. When dealing at this scale, you can't
expect everybody to be happy."
==
Human Ancestors Walked Upright, Study Claims
The ancestors of humanity are often depicted as knuckle-draggers, making
humans seem unusual in our family tree as "upright apes."
ADVERTISEMENT
Controversial research now suggests the ancestors of humans and the other
great apes might have actually walked upright too, making knuckle-walking
chimpanzees and gorillas the exceptions and not the rule.
In other words, "the other great apes we see now, such as chimps or gorillas
or orangutans, might have descended from human-like ancestors," researcher
Aaron Filler, a Harvard-trained evolutionary biologist and medical director at
Cedars-Sinai Institute for Spinal Disorders in Los Angeles, told LiveScience.
Filler analyzed how the spine was assembled in more than 250 living and
extinct mammalian species, with some bones dating up to 220 million years old.
He discovered a series of changes that suggest walking upright-and not with
our knuckles-might actually have been the norm for the ancestors of today's
great apes.
In most creatures with a backbone, the body is separated roughly in half by a
tissue structure that runs in front of the spinal canal. This "horizontal
septum" divides the body into a dorsal part (corresponding to the back side of
humans), and a ventral part (or the front half).
A strange birth defect in what may have been the first direct human ancestor
led this septum to cross behind the spinal cord in the lumbar or lower back
region-an odd configuration more typical of invertebrates. This would have
made horizontal stances inefficient.
"Any mammal with this set of changes would only be comfortable standing
upright," Filler said. "I would envision this malformed young 'hominiform'-the
first true ancestral human-as standing upright from a young age," he added,
while the rest of the mutant's family and species continued to walk around "on
all fours."
This change to an upright posture could have occurred "very abruptly, with
just a few shifts in 'homeotic' genes, or ones responsible for how the body
plan is laid out," Filler said.
The earliest known bipedal apes-those walking on two legs-were thought to date
back as far as some 6 million years or so. Now Filler's new findings suggest
the earliest upright ape known so far was the extinct hominoid, Morotopithecus
bishopi, which lived in Uganda more than 21 million years ago.
"Humanity can be redefined as having its origin with Morotopithecus," Filler
said. He detailed his findings online Oct. 10 in the journal PLoS ONE.
This research pushes back the date for the origins of bipedalism roughly 15
million years, to before the last common ancestor of humans, chimps, gorillas
and orangutans, as well as lesser apes such as gibbons. The results match up
with recent findings that suggest upright walking might have started before
humanity's ancestors even left the trees.
"If you look at baby siamangs, which are a kind of gibbon, you'll see them
walk bipedally on their own," Filler said. "It's just their natural way of
walking. They never knuckle walk."
If bipedalism did evolve 21 million years ago, it more likely evolved to walk
in trees than on the ground, said University of Chicago evolutionary
anthropologist Russell Tuttle. "Twenty-one million years ago, there were a lot
of trees around," he said.
Besides Morotopithecus, fossil vertebrae suggest three other upright ape
species precede the 6 million year mark, Filler added.
"So you have this fossil evidence for bipedalism, and you have apes such as
gibbons," he said. "Perhaps humans represent the primitive condition, and
knuckle walkers such as chimps and gorillas are modified."
The ancestors of chimps and gorillas might have evolved knuckle walking as a
speedier mode of travel, Filler suggested. If bipedalism did come first, that
means gorillas and chimpanzees might have evolved knuckle walking independent
of each other. Future analysis of the genes of those apes could show they came
across knuckle walking in different ways, supporting Filler's ideas.
"I am getting the feeling that a revolution in our thinking about the origins
of bipedality is now under way," said evolutionary anthropologist Robin
Crompton at the University of Liverpool in England.
==
Gilbert Ryle 1949 Concept of Mind
===
http://www.talkorigins.org/faqs/comdesc/section1.html#morphological_intermediates_ex2
reptile/mammal evolution

http://en.wikipedia.org/wiki/Nylon_bug

http://en.wikipedia.org/wiki/Radiotrophic_fungus
===
I don't know if rattlesnakes in general are "evolving not to rattle so much
any more", but there are certain rattlesnakes that live on islands off the
shore of California.  These rattlesnakes have mostly evolved to be
"rattleless" .  They don't have any enemies, apparently, so they don't need
their rattles for anything.  Incidentally, the rattles on a rattlesnake are
the remains of shed skin.  And they apparently can shed more than once a year,
so you can't (exactly) tell their age from the number of rattles at the end of
their tail.
==
A paleontologist, Jurie van den Heever , (with  real PhD) is an expert on
Karoo fossils - these fossils are one of the best examples of macro-evolution
known to man.
Lysosuchus vanderrietei. is one example.
Archaeopteryx, delivered 491 000 hits, and Tiktaalik rosea¹s 34 300 hits.
Van den Heever ³Our Karoo fossils are probably the best example of
macro-evolution in the world.²
Niles Eldredge¹s book ³The Triumph of Evolution:, we read : ³Indeed, the
evolution of mammals from mammal-like reptiles (therapsids) is one of the best
documented examples of macroevolution in the fossil record.²
==
When Darwin published his Origin of Species, not all of his ideas were
completely new to science. Evolution was already widely discussed, but
Darwin's work nailed down the principle so completely, supported it with
observation so well, and presented his case so irrefutably, that it created a
firestorm in his own time. Evolution was a direct threat to cherished beliefs
of millions of people. It undermined their sense of purpose, meaning and
dignity and gave nothing in return to fill that emotional hole.
==
Jurassic Park' Villain Had Feathers
Tiny bumps on the fossilized arm bone of a Velociraptor specimen show that the
carnivorous dinosaur made infamous in the movie "Jurassic Park"had feathers.
The finding, detailed in the Sept. 21 issue of the journal Science, confirms
what scientists have long suspected about the creature as fossils of some of
its close relatives bear imprints of feathers.
The researchers believe the bumps on the arm bone are remnants of quill knobs,
places where the quills of secondary feathersimportant for flight in many
modern birdswere anchored to the bone.
"Finding quill knobs on Velociraptor means that it definitely had feathers,"
said study team member Alan Turner, a paleontology graduate student at the
American Museum of Natural History and at Columbia University in New York.
"This is something we'd long suspected, but no one had been able to prove."
Not for all birds
Quill knobs are most evident in modern birds that are strong flyers, such as
falcons and hawks. Birds that have lost the ability to fly or that primarily
soar, like broad-winged albatrosses, typically lack quill knobs.
While studying the forearm of a Velociraptor specimen unearthed in Mongolia in
1998, the researchers noticed six regularly spaced indentations in the
fossilized bone that appeared remarkably similar to the quill knobs of modern
birds.
In modern birds, secondary feathers are connected to the forearm by way of
ligaments. When the feathers move, they place stress on the bone. The bones
respond to the tug of the feathers by developing these little bumps, Turner
explained. The quill knobs are a side effect of how the feathers anchor.
Velociraptor lived during the late Cretaceous Period about 85 million years
ago and belonged to a group of agile, bipedal dinosaurs called Dromaesoaurs
that were closely related to birds. It was roughly the size of a turkey and
weighed about 30 pounds.
A prehistoric turkey
Despite having feathers, Velociraptor could not fly or even glide, Turner said.
Even though it had really long arms compared to most carnivorous dinosaurs,
theyre not long enough compared to the rest of its body, Turner told
LiveScience.
The researchers suggest that an ancestor of Velociraptor might have lost the
ability to fly but retained its feathers anyway. The feathers might also have
been used for display, to shield nests, for temperature control or to help the
dinosaur maneuver while running.
The new finding is just the latest example of how remarkably alike modern day
birds and their closely related dinosaur ancestors were, said study team
member Mark Norell, a curator in the AMNHs Division of Paleontology.
Both have wishbones, brooded their nests, possess hollow bones and were
covered in feathers, Norell said. "If animals like Velociraptor were alive
today our first impression would be that they were just very unusual looking
birds."
==
Slimy Salamanders Caught Crossbreeding
A hybrid of two salamander varietiesone of which is an endangered speciesis
outshining both if its slimy parents' purebred offspring in the game of life.
Breeding between endangered California tiger salamanders and the invasive
barred salamanders, commonly used as fishing bait and introduced decades ago, has created swarms of new salamanders.
The hybrid salamanders are more likely to survive than either parent species,
researchers have discovered. The competitive debacle is causing some
scientists to reconsider the supposedly weak role of such hybrids in the
course of evolution.
The two species have evolved independently for millions of years and are about
as genetically different from one another as are humans and chimpanzees, the
researchers said.
"The mixture of genes from organisms that are distinct enough to be called
separate species don't usually produce healthy, fit offspring," said Benjamin
Fitzpatrick, an evolutionary biologist at the University of Tennessee in
Knoxville.
Ecologists are concerned the hybrids are pushing the California tiger
salamander closer to the brink of extinction, calling the study "one of the
first demonstrations of this threat."
The researchers don't know why the hybrids are thriving. "The hybrids could be
more resistant to disease, better able at escaping predators, or more efficient
at gathering food than their parent species," Fitzpatrick said.
A study of the salamander crossbreed is detailed in a recent issue of the The
Proceedings of the National Academy of Sciences.
===
Earth's First Breath Came Earlier Than Thought
Earth took its first breath of oxygen 50 to 100 million years earlier than
previously thought, suggesting our planet and the life on it "co-evolved," new
studies claim.
The two studies reveal that small amounts of oxygen were present in the oceans
and possibly in the atmosphere around 2.5 billion years ago, indicating
possibly that oxygen-producing microbes, such as cyanobacteria, were already
pumping out this lung-filling ingredient, the researchers say.
Some scientists had thought the evolution of these organisms triggered the
recorded surge in oxygen on Earth called the Great Oxidation Event between 2.3
billion and 2.4 billion years ago. Why did it take up to 100 million years
between the initial puffs of atmospheric oxygen and the Oxidation Event
Because nature is not so simple. The authors suggest a complex and
interdependent dance between biological and geological processes can explain
the gap. "It becomes a co-evolutionary dance or interplay," said Ariel Anbar,
a biogeochemist at Arizona State University and lead author of one of the
studies.
An outside scientist not involved in either study, Carl Pilcher, director of
the NASA Astrobiology Institute, expanded on the idea of an intricate link
between life and the planet. "Studying the dynamics that gave rise to the
presence of oxygen in Earths atmosphere deepens our appreciation of the
complex interaction between biology and geochemistry, Pilcher said. The new
results "support the idea that our planet and the life on it evolved together.
Both studies are detailed in the Sept. 28 issue of the journal Science.
Fresh find
The history of life on Earth is closely tied to the emergence of oxygen in the
atmosphere. However, until now, little was known of environmental changes
before the Oxidation Event.
To get at that, both research teams analyzed layers of rock in a
3,000-foot-long (914 meters) core drilled from the Hamersley Basin in Western
Australia. They examined chemicals whose presence is linked with oxygen,
including sulfur compounds and metals like molybdenum and rhenium.
They found evidence that there was a small but significant amount of oxygen
present in the oceans and possibly Earth's atmosphere just prior to the end of
the Archean Eon (about 3.9 billion to 2.5 billion years ago), when microbial
life on Earth is thought to have arisen and diversified.
"Together, these [studies] provide compelling evidence for a shift in the
oxidation state of the surface ocean 50 million years before the Great
Oxidation Event," said Alan Jay Kaufman, a geochemist at the University of
Maryland and lead author of the second new study. "We believe that these
findings are a significant step in our understanding of the oxygenation of
Earth because they link changes in the environment with that of the biosphere."
Breathing microbes
The newly discovered "whiff" of oxygen didn't just appear out of nowhere.
"The data show that oxygen existed in the environment before the Great
Oxidation Event and strongly suggests that photosynthesis that produced oxygen
was around before then," Anbar told LiveScience.
Other phenomena, however, could also explain the findings, said Andrey Bekker
of the Carnegie Institution of Washington.
Bekker, who was not involved in either of the current studies, notes that
photochemical processes, in which chemical reactions are driven by different
wavelengths of light, can lead to changes in the relative amounts of different
forms of sulfur, for instance.
If the biological interpretation is correct, some process must have kept the
oxygen being produced in check for millions of years, up until the Great
Oxidation Event. "Why didn't oxygen rise in the atmosphere as soon as that
metabolism evolved?" Anbar said.
Anbar suggests non-biological processes could play a role. "There are
geological processes that consume oxygen, so even when biology is pumping it
into the environment it doesn't necessarily rise strongly in the atmosphere
right away," Anbar said.
Some gases spewed from different types of volcanoes can consume oxygen, and so
as volcanic activity changed over time so would the amount of oxygen in the
environment.
==
There are, in fact, over half a dozen species of extinct whale ancestors many
with their own Wikipedia entries showing a clear development from prehistoric
land-dwelling carnivores to todays whales and dolphins. Two of these were
co-discovered by Philip Gingerich.
==
Scientists have discovered a real gender-bender of a bug, a species in which
most females impersonate males.
Past research had already revealed the male bugs possessed fake female
genitalia.
"We ended up uncovering a hotbed of deception," said evolutionary biologist
Klaus Reinhardt at the University of Sheffield in England. "Nothing like this
exists anywhere else in the animal kingdom."
Reinhardt and his colleagues investigated remote and dangerous bat caves in
East Africa for the bloodsucking African bat bug (Afrocimex constrictus), a
close relative of the bed bug. The bats were reportedly hosts for Ebola and
other lethal viruses.
"We had to work in containment suits with full-faced respirators in sweltering
temperatures for hours at end," Reinhardt said.
Sex among bat bugs (as with bed bugs) is violent. During copulation, males of
these species pierce the abdomens of their mates with their genitals and
ejaculate directly into their blood.
The researchers originally set out to investigate bat bugs in the hopes of
shedding light on "one of nature's strangest phenomena why males had female
genitalia," Reinhardt said.
Unlike bed bugs, male African bat bugs have bogus female genitalsa fact the
scientists freely call "bizarre." Past research found they mate with each
other as well as with females. Although the sham genitals are convincingly
intricate, they do not have a covering over them as real female genitals do.
Surprisingly, the scientists have now discovered that female African bat bugs
practiced gender-bending also by impersonating males. Only one out of six
females possessed conventional female genitals, while the rest had genitals
resembling the fakes seen on males.
By masquerading as males, females enjoy less sexual attention. Given that sex
leads to wounding in these bugs, Reinhardt and his colleagues suggest avoiding
the trauma of sex makes sense. Indeed, the researchers discovered females that
impersonated males had far less fewer than more conventional females.
As to why any females still retain conventional genitalia given the wounds
they accrue"no idea," Reinhardt told LiveScience. Normal females might lay
more eggs, "but in order to address this question you would need controlled
lab studies, and we have not yet succeeded in breeding these animals."
It also remains a mystery as to why males possess sham female genitals.
Scientists think the males might genitally stab any adult bat bug, so one
conjecture as to why males evolved bogus female genitals involves guiding
stabs to relatively safe parts of the anatomy.
"Our results suggest that the battle of the sexes is a very powerful
evolutionary force which can result in very bizarre adaptations," Reinhardt
said.
==
http://www.thetheisticevolutionpage.org/ape_babies.htm
=====
The largest classification in the Linnaean system is kingdom. There are
5: Monera (bacteria), Protista (all the non bacterial mono-cellular organisms),
Fungi (organisms like molds and mushrooms), Plantae (plants), and Animalia
(animals).
The next classification is phylum. There are innumerable phyla within the
kingdom Animalia, and only one is even a close fit for humans, since all the
others are either creatures with exoskeletons, shells, worms, or things like
jelly fish and sponges (which clearly bear little resemblance to humans), that
is Chordata. This phylum is defined as creatures which at some point in their
development have a spinal cord of nervous tissue. So not only are humans
animals but they are more specifically chordates.

The next taxon from largest from smallest after class is order. Mammalian
orders include Artiodactyla (even toed hoofed animals), Carnivora (lions and
tigers and bears... oh my!), Insectivora (moles and shrews), Lagomorpha
(rabbits and hares), Perissodactyla (horses rhinos and their relatives),
Primate, (monkeys lemures and apes), Proboscidae (elephants and their extinct
relatives), and Rodentia (rodents... not rabbits).  
===
"Fossil Record" by Mike Benton

Early mineralization of soft tissues may be achieved in pyrite,
phosphate or carbonate, depending on three factors:
(1) rate of burial, (2) organic content and (3) salinity.
Early diagenetic pyritization (Figure 2b) of soft parts is favoured by
rapid burial, a low organic content, and the presence of sulfates in
the sediment. Early diagenetic phosphatization (Figure 2c) requires a
low rate of burial and a high organic content. Soft-part preservation
in carbonates (Figure 2d) is favoured by rapid burial in organic-rich
sediments; at low salinity levels, siderite is deposited, and at high
salinity levels, carbonate is laid down in the form of calcite.
===
There is an earlier hominid, the species
whose remains have been found in the Caucasus nation
of Georgia (Dmanisi), dating from about 1.77 million
years ago (older even than the remarkable Turkana boy
fossil from Kenya)
==
More on Fly Evolution

Diptera ("two wings") evolved, as noted previously, in
the Triassic from the standard four-winged pattern for
flying insects. "Mutations" in a single Hox gene,
Ubx, caused this momentous development. Switching
this turned off gene back on produces fruit flies with
four wings, like their Paleozoic ancestors from 250
million years ago, instead of the now normal Dipteran
plan, with one pair of wings & one pair of halteres,
vestigial wings:

http://crossandflam e.com/forum/ link.php? url=http: //users.rcn.
com/jkimball. ma.ultranet/ BiologyPages/ H/HomeoboxGenes. html

Article on the Mesozoic adaptive radiation of the
Dipteran suborder Brachycera, which contains "fruit
flies", showing that all its major lineages evolved
before the development of flowering plants:

ftp://statgen. ncsu.edu/ pub/thorne/ mypapers/ wiegsysbio03. pdf

Its family tree based on rDNA & morphology places the
Drosophilidae family as sister group to that of the
common house fly family, Muscidae. The true fruit
flies, the Tephritidae, are classed into a different,
large group, the Acalyptratae, none of whose members
are blood-feeders (hematophagous) , despite being
otherwise highly diverse in their habits.

Drosophila species have also developed pesticide
resistance amazingly rapidly & widely in a mere 40
years, thanks to transposable elements or "selfish
DNA".

http://www.genetica rchaeology. com/Research/ Selfish_DNA_ driving_insectic
ide_resistance. asp

That D. melanogaster is capable of making choices
suggests the possibility of rudimentary free will in
flies:

http://www.msnbc. msn.com/id/ 18684016/

An important source of genetic variation is gene
transfer from bacteria & viruses into their host
species. The world's most successful parasites,
Wolbachia bacteria, have inserted themselves into
Drosophila genomes, with a number of consequences,
including making it easier to trace Drosophila
evolution:

http://notexactlyro cketscience. wordpress. com/2007/ 08/30/an-
entire-bacterial -genome-discover ed-inside- that-of-a- fruit-fly/
===
just some clips;

==
Many important biomolecules are thermally unstable in aqueous media;
for instance, functionalized sugars (both aminated and phosphorylated),
peptides, polyphosphates, or thioesters will not survive long in water
under hot hydrothermal conditions (e.g., Larralde et al. 1995; Shapiro
1995). Nitriles, such as cyanoacetylene and cyanoacetaldeyde  proposed
as possible prebiotic precursors for pyrimidines (Robertson & Miller
1995)
will be rapidly hydrolyzed to carboxylic acids in hot water (Siskin et
al. 1990). Therefore, if the synthesis of nucleotides and their
subsequent
oligomerization to promote an "RNA" world is requisite to the emergence
of life, then such chemistry would be extremely improbable
(and likely impossible) in high-temperature water
(e.g., Miller & Lazcano 1995).
===
The discovery of hydrothermal vents at the oceanic ridge crests and
the appreciation of their significance in the element balance of the
hydrosphere represents a major development in oceanography [126].
Since the process of hydrothermal circulation probably began early in
the Earths history, it is likely that vents were present in the Archean
oceans. Large amounts of ocean water now pass through the vents,
with the whole ocean going through them every 10 million years [127].
This flow was probably greater during the early history of the Earth,
since the heat flow from the planets interior was greater during
that period. The topic has received a great deal of attention, partly
because of doubts regarding the oxidization state of the early
atmosphere. Following the first report of the vents existence,
a detailed hypothesis suggesting a hydrothermal emergence of life
was published [128], in which it was suggested that amino acids and
other organic compounds are produced during passage through the
temperature gradient of the 350 C vent waters to the 0 C ocean waters.
Polymerization of the organic compounds thus formed, followed by their
self-organization, was also proposed to take place in this environment,
leading to the first forms of life.
At first glance, submarine hydrothermal springs would appear
to be ideally suited for creating life, given the geological
plausibility of a hot early Earth. More than a hundred vents
are known to exist along the active tectonic areas of the Earth,
and at least in some of them catalytic clays and minerals interact
with an aqueous reducing environment rich in H2, H2S, CO, CO2,
and perhaps HCN, CH4, and NH3.
Unfortunately it is difficult to corroborate these speculations with
the findings of the effluents of modern vents, as a great deal of the
organic material released from modern sources is diagenized biological
material, and it is difficult to separate the biotic from the abiotic
components of these reactions. Much of the organic component of
hydrothermal
fluids may be formed from diagenetically altered microbial matter.
So far, the most articulate autotrophic hypothesis stems from
the work of Wachtershauser [129,130], who has argued that life
begun with the appearance of an autocatalytic, two-dimensional
chemolithtrophic metabolic system based on the formation of the
highly insoluble mineral pyrite (FeS2).
The reaction FeS + H2S -> FeS2+ H2 is very favorable.
It is irreversible and highly exergonic with a standard
free energy change ?G = -9.23 kcal/mol, which corresponds
to a reduction potential E = -620 mV. Thus, the FeS/H2S
combination is a strong reducing agent, and has been shown
to provide an efficient source of electrons for the reduction
of organic compounds under mild conditions. The scenario proposed
by Wachtershauser [129,130] fits well with the environmental
conditions found at deep-sea hydrothermal vents, where H2S, CO2,
and CO are quite abundant. The FeS/H2S system does not reduce CO2
to amino acids, purines, or pyrimidines, although there is more
than adequate free energy to do so [131]. However, pyrite formation
can produce molecular hydrogen, and reduce nitrate to ammonia,
and acetylene to ethylene [132]. More recent experiments have shown
that the activation of amino acids with carbon monoxide and (Ni,Fe)S
can lead to peptide-bond formation [133]. In these experiments,
however, the reactions take place in an aqueous environment to which
powdered pyrite has been added; they do not form a dense monolayer
of ionically bound molecules or take place on the surface of pyrite.
None of the experiments using the FeS/H2S system reported so far
suggests that enzymes and nucleic acids are the evolutionary outcome
of surface-bounded metabolism. The results are also compatible with
a more general model of the primitive soup in which pyrite formation
is an important source of electrons for the reduction of organic com-
pounds. It is possible that under certain geological conditions the
FeS/H2S combination could have reduced not only CO but also CO2
released from molten magna in deep-sea vents, leading to biochemical
monomers [134]. Peptide synthesis could have taken place in an iron
and nickel sulfide system [133] involving amino acids formed by elec-
tric discharges via a Strecker-type synthesis,

although this scenario requires the transportation of compounds formed
at the surface to the deep-sea vents [135]. It seems likely that
concentrations of reactants would be prohibitively low
based on second-order reaction kinetics.

If the compounds synthesized by this process did not remain bound
to the pyrite surface, but drifted away into the surrounding aqueous
environment, then they would become part of the prebiotic soup, not
of a two-dimensional organism.

=================================
In general, organic compounds are decomposed rather than created
at hydrothermal vent temperatures, although of course temperature
gradients exist. As has been shown by Sowerby and coworkers [136],
concentration on mineral surfaces would tend to concentrate any
organics created at hydrothermal vents in cooler zones, where other
reaction schemes would need to be appealed to.
=================================

The presence of reduced metals and the high temperatures of
hydrothermal vents have also led to suggestions that reactions
similar to those in FischerTrospch-type (FTT) syntheses may be
common under such regimes. It is unclear to what extent this is
valid, as typical FTT catalysts are easily poisoned by water and
sulfide. It has been argued that some of the likely environmental
catalysts such as magnetite may be immune to such poisoning [137].

Stability of Biomolecules at High Temperatures
A thermophilic origin of life is not a new idea. It was first suggested
by Harvey [138], who argued that the first life forms were het-
erotrophic thermophiles that had originated in hot springs such as
those found in Yellowstone Park. As underlined by Harvey, the one
advantage of high temperatures is that the chemical reactions could
go faster and the primitive enzymes could have been less efficient.
However, high temperatures are destructive to organic compounds.
Hence, the price paid is loss of biochemical compounds to decomposition.
Although some progress has been made in synthesizing small
molecules under hydrothermal vent type conditions, the larger trend
for biomolecules at high-temperature conditions is decomposition. As
has been demonstrated by various authors, most biological molecules
have half-lives to hydrolysis on the order of minutes to seconds at
the high temperatures associated with hydrothermal vents. As noted
above, ribose and other sugars are very thermolabile compounds [79].
The stability of ribose and other sugars is problematic, but pyrimidines
and purines, and many amino acids, are nearly as labile. At 100 C
the half-life for deamination of cytosine is 21 days, and 204 days for
adenine [139,140]. Some amino acids are stable, for example, alanine
with a half-life for decarboxylation of approximately 19,000 years
at 100 C, but serine decarboxylates to ethanolamine with a half-life of
320 days [141]. White [142] measured the decomposition of various com-
pounds at 250 C and pH 7 and found half-lives of amino acids from 7.5 s
to 278 min, half-lives for peptide bonds from <1min to 11.8 min,
half-lives for glycoside cleavage in nucleosides from <1s to 1.3 min,
decomposition of nucleobases from 15 to 57min, and half-lives for
phosphate esters from 2.3 to 420 min. It should be borne in mind
that the half-lives for polymers would be even shorter as there
are so many potential breakage points in a polymer. Thus, while
the vents may serve as synthesis sites for simpler compounds such
as acetate or more refractory organic compounds such as fatty acids,
it is unlikely they played a major role in synthesizing most
biochemicals or their polymers.

350C submarine vents do not seem to presently synthesize organic
compounds, more likely they decompose them in a time span ranging
from seconds to a few hours. Thus, the origin of life in the vents is
improbable. This does not imply that the hydrothermal springs were a
negligible factor on the primitive Earth. If the mineral assemblages
were sufficiently reducing, the rocks near the vents may have been
a source of atmospheric CH4 or H2. As stated earlier, the concentra-
tions of biomolecules which could have accumulated on the primitive
Earth is governed largely by the rates of production and the rates
of destruction. Submarine hydrothermal vents would have also been
important in the destruction rather than in the synthesis of organic
compounds, thus fixing the upper limit for the organic compound
concentration in the primitive oceans. Although it is presently not
possible to state which compounds were essential for the origin of life,
it does seem possible to preclude certain environments if even fairly
simple organic compounds were involved [143].


79. Larralde, R., M. Robertson and S. Miller.
Rates of decomposition of ribose and other sugars:
implications for chemical evolution. Proceedings of
the National Academy of Sciences USA, 92:815860, 1995.
126. Corliss, J., J. Dymond, L. Gordon, J. Edmond,
R. von Herzen, R. Ballard, K. Green, D. Williams,
A. Bainbridge, K. Crane and T. van Andel. Submarine
thermal springs on the Galapagos Rift. Science, 203:107383, 1979.
127. Edmond, J., K. Von Damn, R. McDuff and C. Measures. Chemistry of
hot springs on the east Pacific Rise and their effluent dispersal.
Nature, 297:18791, 1982.
128. Corliss, J., J. Baross and S. Hoffman.
An hypothesis concerning the relationship between
submarine hot springs and the origin of life on Earth.
Oceanologica Acta, 4 Suppl, 5969, 1981.
129. Wachtershauser, G. Before enzymes and templates:
theory of surface metabolism. Microbiological Reviews,
52:45284, 1988.
130. Wachtershauser, G. Groundworks for an
evolutionary biochemistry: the iron-sulphur world.
Progress in Biophysical Molecular Biology
58:85201,1992.
131. Keefe, A., S. Miller, G. McDonald and J. Bada.
Investigation of the prebiotic synthesis of amino acids
and RNA bases from CO2 using FeS/H2S as a reducing agent.
Proceedings of the National Academy of Sciences USA,
92:119046, 1995.
132. Maden, B. No soup for starters? Autotrophy and
origins of metabolism. Trends in Biochemical Sciences,
20:33741, 1995.
133. Huber, C. and G. Wachtershauser. Peptides by
activation of amino acids with CO on (Ni, Fe)S surfaces
and implications for the origin of life.
Science, 281:6702, 1998.
134. Orgel, L. The origin of lifea review of facts
and speculations. Trends in Biochemical Sciences,
23:4915, 1998.
135. Rode, B. Peptides and the origin of life.
Peptides, 20:77386, 1999.
136. Sowerby, S., C. Morth and N. Holm. Effect
of temperature on the adsorption of adenine.
Astrobiology, 1(4):4817, 2001.
137. Holm, N. and E. Andersson. Hydrothermal systems.
In Brack, A. (Ed.), The Molecular Origins of Life:
Assembling the Pieces of the Puzzle (pp.8699).
Cambridge University Press, Cambridge, 1998.
138. Harvey, R. Enzymes of thermal algae. Science, 60:4812, 1924.
139. Garrett, E. and J. Tsau. Solvolyses of cytosine and cytidine.
Journal of Pharmaceutical Sciences, 61(7):105261, 1972.
140. Shapiro, R. The prebiotic role of adenine:
a critical analysis. Origins of Life and Evolution
of the Biosphere, 25:8398, 1995.
141. Vallentyne, J. Biogeochemistry of organic matter.
II. Thermal reaction kinetics and transformation products
of amino compounds. Geochimica et Cosmochimica Acta, 28:15788, 1964.
142. White, R. Hydrolytic stability of biomolecules
at high temperatures and its implication for life at 250
C. Nature, 310(5976):4302, 1984.
143. Cleaves, H. and J. Chalmers. Extremophiles may
be irrelevant to the origin of life. Astrobiology, 4(1):19, 2004.
144. Oro, J. Comets and the formation of biochemical
compounds on the primitive Earth. Nature, 190:4423, 1961.


"Unless the molecule can literally copy itself,"
Joyce and Orgel note, "that is, act simultaneously
as both template and catalyst, it must encounter
another copy of itself that it can use as a template."
Copying any given RNA in its vicinity will lead to
an error catastrophe, as the population of RNAs
will decay into a collection of random sequences.
But to find another copy of itself, the self-replicating
RNA would need (Joyce and Orgel calculate)
a library of RNA that "far exceeds
the mass of the earth."

Joyce G.F. & Orgel L.E., "Prospects for Understanding
the Origin of the RNA World," in "The RNA World,"
Gesteland R.F. & Atkins J.F., eds.



Joyce and Orgel suggest that one must reject
the myth of a self-replicating RNA molecule that arose de novo
from a soup of random polynucleotides. Not only is such a notion
unrealistic in light of our current understanding of prebiotic
chemistry, but it should strain the credulity of even an optimist's
view of RNA's catalytic potential. If you doubt this, ask yourself
whether you believe that a replicase ribozyme would arise in a
solution containing nucleoside 5'-diphosphates and
polynucleotide phosphorylase!

Joyce G.F. & Orgel L.E.,
"Prospects for Understanding the Origin
of the RNA World," in "The RNA World,"
Gesteland R.F. & Atkins J.F., eds.


Abstract
I examine the plausibility of theories that postulate the development
of complex chemical organization without requiring the replication
of genetic polymers such as RNA. One conclusion is that theories
that involve the organization of complex, small-molecule metabolic
cycles such as the reductive citric acid cycle on mineral surfaces
make unreasonable assumptions about the catalytic properties of
minerals and the ability of minerals to organize sequences of
disparate reactions. Another conclusion is that data in the Beilstein
Handbook of Organic Chemistry that have been claimed to support
the hypothesis that the reductive citric acid cycle originated as a
self-organized cycle can more plausibly be interpreted
in a different way.

<...>

One possible saving hypothesis is that the molecules that
are the carriers of the cycle are also catalysts for the difficult
reactions of the cycle. Unfortunately, catalytic reactions of
the required kind in aqueous solution are virtually unknown;
there is no reason to believe, for example, that any intermediate
of the citric acid cycle would specifically catalyze any reaction
of the citric acid cycle. The explanation of this is simple:
noncovalent interactions between small molecules in
aqueous solution are generally too weak to permit large
and regiospecific catalytic accelerations. To postulate
one fortuitously catalyzed reaction, perhaps catalyzed
by a metal ion, might be reasonable, but to postulate
a suite of them is to appeal to magic.

The idea that a complex polymerization reaction such as the
formose reaction or the polymerization of hydrogen cyanide
is likely to simplify to a specific cycle under the influence of
autocatalysis in aqueous solution is implausible. It is not
logically impossible that such an autocatalytic cycle exists,
but because it seems very unlikely from what we already
know about the chemistry of aqueous solutions,
the burden of proof lies with the proposers of such cycles.

Wachtershauser has put forward a very specific hypothesis that,
if correct, would overcome all of the difficulties discussed above.
In a scenario that he describes as Two-Dimensional Chemi-Autotrophic
Surface Metabolism in an Iron-Sulfur World (9), he proposes that
the reductive citric acid cycleand much other organized, nonenzymatic
chemistry occurred on the primitive earth, but on the surface of
iron sulfide minerals rather than in aqueous solution. Wachtershauser
points out that the conversion of ferrous sulfide (FeS) to pyrites
(FeS2)
in the presence of hydrogen sulfide makes available reducing power
equivalent to molecular hydrogen. This reducing power could be used
to convert carbon dioxide to carbon-containing metabolites.
Wachtershauser also claims that the surface of iron sulfide would
constrain the spatial distribution and orientation of the newly
formed products of reduction in such a way as to support
complex sequences of metabolic reactions.

In summary, it seems very likely that minerals played an important part
in prebiotic chemistry, both as simple adsorbents and as catalysts.
A single mineral is unlikely to have functioned as a specific catalyst
for several unrelated reactions. Even if the members of a suite of
minerals could each catalyze one step in a complex cycle, it does not
seem likely that the cycle would self-organize on their surfaces.
Any suite of minerals that included catalysts for each step of the cycle
would be likely to include, in addition, catalysts for reactions that
disrupt the cycle. Efficient transport of the intermediates from one
catalytic mineral to another would also present severe problems.
There is at present no reason to expect that multistep cycles
such as the reductive citric acid cycle will self-organize
on the surface of FeS/FeS2 or some other mineral.
While it seems almost impossible that a cycle of reactions as
complicated as the reductive citric acid cycle could self-organize
on a mineral surface, Wachterhauser's suggestion does raise an
interesting and important question. How much self-organization
is it reasonable to expect on a mineral surface in the absence
of evolved, informational catalysts? Clearly, a simple surface
could reasonably be expected to carry out a series of reactions of
essentially the same type, say a series of aldol and reverse
aldol reactions of the type involved in the formose reaction [.],
or a series of reductions of the type involved in the reductive
citric acid cycle. It is not clear that any surface is likely
to catalyze two or more unrelated chemical reactions, but it
would be interesting to try to discover multifunctional surfaces.
The problem of stereospecificity of a sequence of similar reactions
in aqueous solution or on a mineral surface is equally difficult.
Repetition of some basic reaction with constant stereospecificity
does not seem unlikely, because it is routinely achieved by
polymer chemists. Catalysis of a sequence of reactions, each
with a different defined stereospecificity, seems much less plausible.
Just how far one can go in the direction of self-organization
on mineral surfaces is a question for the future. One can be sure
that the complete reverse citric acid cycle is out of range, but
it is not obvious that some much simpler cycle relevant to the
origin of life is impossible. Huber and Wachtershauser have
noted the possibility of such a cycle in a footnote added in
proof to ref. 23, but it is not clear whether this cycle is
intended to augment the citric acid cycle or replace it.
The demonstration of a simple specific version of the
formose reaction, for example, would be important, but
studies of the specificity of the formose reaction when
catalyzed by minerals have been disappointing (23).

23. Schwartz A W, de Graaf R M. J Mol Evol. 1993;36:101106.

The novel, potentially replicating polymers that have been described
up to now, like the nucleic acids, are formed by joining together
relatively complex monomeric units. It is hard to see how any could
have accumulated on the early earth. A plausible scenario for the
origin of life must, therefore, await the discovery of a genetic polymer
simpler than RNA and an efficient, potentially prebiotic, synthetic
route to the component monomers. The suggestion that relatively
pure, complex organic molecules might be made available in large
amounts via a self-organizing, autocatalytic cycle might, in principle,
help to explain the origin of the component monomers. I have
emphasized the implausibility of the suggestion that complicated
cycles could self-organize, and the importance of learning more
about the potential of surfaces to help organize simpler cycles.

Postulate 2: Beta-D ribonucleotides spontaneously form polymers
linked together by 3', 5'-phosphodiester linkages (i.e., they link to
form molecules of RNA).

Joyce and Orgel discuss candidly the problems with this postulate.
They note that nucleotides do not link unless there is some type of
activation of the phosphate group. The only effective activating groups
for the nucleotide phosphate group (imidazolides, etc.), however, are
those that are totally implausible in any prebiotic scenario. In living
organisms today, adenosine-5'-triphosphate (ATP) is used for activation
of nucleoside phosphate groups, but ATP would not be available
for prebiotic syntheses. Joyce and Orgel note the possible use
of minerals for polymerization reactions, but then express
their doubts about this possibility:

=================================================
Whenever a problem in prebiotic synthesis seems intractable,
it is possible to postulate the existence of a mineral that
catalyzes the reaction...such claims cannot easily be refuted.
=================================================
-
G.F. Joyce and L.E. Orgel,
"Prospects for understanding the origin of the RNA World,"
in The RNA World, eds. R.F. Gesteland and J.F. Atkins
(Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory Press, 1993), pp. 1-25.
===
Gerald Joyce and Leslie Orgel-two scientists who
have worked on the origin of life problem-call RNA
`the prebiotic chemist's nightmare.
`Scientists interested in the origins of life seem to divide
neatly into two classes. The first, usually but not always
molecular biologists, believe that RNA must have been the
first replicating molecule and that chemists are exaggerating
the difficulties of nucleotide synthesis.... The second
group of scientists are much more pessimistic. They believe
that the de novo appearance of oligonucleotides on the
primitive earth would have been a near miracle.
(The authors subscribe to this latter view).
Time will tell which is correct.
[Joyce G.F. & Orgel L.E., "Prospects for Understanding the Origin
of the RNA World," in "The RNA World," Gesteland R.F. & Atkins J.F.,
eds. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor NY, 1993, p.19]

Even if the miracle-like coincidence should occur and RNA be produced,
however, Joyce and Orgel see nothing but obstacles ahead. In an article
section entitled "Another Chicken-and-Egg Paradox" they write the
following:
This discussion ... has, in a sense, focused on a straw man:
the myth of a self-replicating RNA molecule that arose de novo
from a soup of random polynucleotides. Not only is such a notion
unrealistic in light of our current understanding of prebiotic
chemistry, but it should strain the credulity of even an optimist's
view of RNA s catalytic potential.... Without evolution it appears
unlikely that a self-replicating ribozyme could arise, but without
some form of self-replication there is no way to conduct an
evolutionary search for the first, primitive self-replicating
ribozyme.' [Joyce & Orgel, 1993, p.13
===
Incubation of the pool RNA...led to rapid and extensive aggregation;
more than half of the pool RNA precipitated when incubated for 90
minutes at 37 C in high concentrations of Mg2+ and monovalent
ions...and
precipitation was even more rapid at higher temperatures. It appears
that conditions that favor RNA intramolecular structure also stabilize
intermolecular interactions; as molecules find regions of
complementarity with more than one other molecule, RNA networks
form and eventually become too large to remain in solution.

David P. Bartel and Jack W. Szostak,
"Isolation of New Ribozymes from a
Large Pool of Random Sequences,
" Science 261 (1993): 1411-1418; p. 1412.
===

===
The researchers, working at the Cambridge-based
Broad Institute of Harvard and MIT, used a wealth
of newly available genetic data to estimate the
time when the first human ancestors split from
the chimpanzees. The team arrived at an answer
that is at least 1 million years later than
paleontologists had believed, based on
fossils of early, humanlike creatures.
The lead scientist said that this jarring conflict
with the fossil record, combined with a number of
other strange genetic patterns the team uncovered,
led him to a startling explanation: that human
ancestors evolved apart from the chimpanzees
for hundreds of thousands of years, and then
started breeding with them again before
a final break.
This contradiction could be resolved, Reich said,
if early creatures like Toumai then interbred with
chimpanzee ancestors, leaving a population of hybrids
that developed into today's humans. (In this scenario,
the line of Toumai creatures then went extinct.)
But it is also possible, he said, that the dating
of the early human fossils is wrong, or that the
dating of other, older fossils used in his
calculations is wrong, which would partially
undercut the interbreeding theory.
For each pair of segments, they then calculated
how long it would have taken to accumulate all
the differences. The team used sophisticated
statistical techniques to calculate these
"divergence times."
This analysis brought surprises that the team
could explain only by suggesting human ancestors
and chimpanzee ancestors interbred. First, they
found that the divergence times varied widely.
Some parts of the DNA seemed to indicate the
human and chimpanzee species had been apart
much longer than others, by millions of years.
If humans split from chimps and then interbred
before splitting again, the more divergent
DNA sequences could date to before the first split,
while the less divergent sequences could date
to just before the second split.
===
this from the American Geological Institute
in cooperation with The Paleontological Society;
==
The earliest humans almost certainly walked upright on two legs but may have
struggled to run at even half the speed of modern man, new research suggests.
===
The biological community has used the tiny fruit fly (Drosophila) to conduct
thousands of experiments. Students in biology classes work with fruit flies,
crossing various types to produce inheritance patterns. Today, there are many
thousands of publications dealing with the fruit fly and to secular biologists,
it is the creature for investigating evolutionary genetics. This insect
is used because genetically it is relatively simple, having four pairs of
easily observed chromosomes containing only 13,000 genes (DNA). In March of
2000 the entire genome (the totality of genes) of the fruit fly was sequenced.
Species don't usually evolve into new families or orders in one fell swoop,
which is the straw man raised by this typically lying creationist charlatan.
There are several genera of fruit flies in more than one family of the order
Diptera. For a fruit fly to evolve into "something else" all that's required is
for the species to adopt a medium other than fruit for laying its eggs.
As long ago as 1957 Dobzhansky published a classic paper in Nature, arguably
the premier science journal in the world, on creating a new species of
Drosophila "fruit fly" in his lab. Drosophila melanogaster shows remarkable
genetic variation over its cosmopolitan range & changes over time. It's easy to
make new species out of it & indeed to derive from a population of it new
species that aren't actually fruit flies, ie lay their eggs in something other
than fruit, as has happened repeatedly in nature. As an embryo develops, its
body plan arises under the direction of developmental control genes which
includes a group called the homeobox, or Hox genes. The bithorax gene is part
of the Hox genes which, if mutated, may produce a four-winged fruit
fly (they normally have two). It is said that "in many cases, experimentally
induced mutations in homeotic genes create drastic changes in the [basic body
design],"3 and one non-creationist stated, Control genes like homeotic genes
may be the target of mutations that would conceivably change phenotypes, but
one must remember that, the more central one makes changes in a complex system,
the more severe the peripheral consequences become. . . . Homeotic changes
induced in Drosophila genes have led only to monstrosities, and most
experimenters do not expect to see a bee arise from their [fruit fly]
constructs. Numerous beneficial mutations occur in D. melanogaster
& other Drosophila species, as they do in all species, including those which
allow insects with these genetic modifications not only to keep on flying, but
to do better under changed circumstances than its parental population.
1. Adams, M. D., et al., "The Genome Sequence of
Drosophila melanogaster, " Science 287, March 24, 2000, pp. 2185-2195.
==
http://www.youtube.com/watch?v=pMHNnhAEDN4  evolution
====
A modified polio virus for one. In the August 9, 2002 edition
of 'Science,' Cello, Paul and Wimmer reported making self-
reproducing, infective virus from simple, non-living bottled
chemicals from the laboratory shelves.
Would it be safe to say that there was a chemical reaction, produced
from the properties of the chemical itself?
They used a nucleic acid sequence they obtained on the internet
for the poliovirus and changed
it a bit here and there so they could not confuse their construct
with any natural virus out there. They whipped up the DNA from
nucleotides, spliced the sequences together, allowed an enzyme (a
protein) to transcribe the DNA into RNA (since poliovirus is a
retrovirus and uses RNA to store information) . The RNA then
replicated in cell-free extract (a soup of simple non-living salts
and molecules) and then the virus was used to infect mice, where it
reproduced in their cells and crippled the animals.
===
http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/S/Speciation.html
==
Numbers of species

Insects make up the vast majority of animal species.

As a soft guide, however, the numbers of identified modern species as of 2004
can be broken down as follows: [3]

287,655 plants, including:

15,000 mosses,
13,025 ferns,
980 gymnosperms,
199,350 dicotyledons,
59,300 monocotyledons;

74,000-120,000 fungi[3];
10,000 lichens;
1,250,000 animals, including:

1,190,200 invertebrates:

950,000 insects,
70,000 mollusks,
40,000 crustaceans,
130,200 others;

58,808 vertebrates:

29,300 fish,
5,743 amphibians,
8,240 reptiles,
10,234 birds, (9799 extant as of 2006)
5,416 mammals.

However the total number of species for some phyla may be much higher:

5-10 million bacteria[4];
1.5 million fungi[3];
==
Moth study backs classic 'test case' for Darwin's theory
By Steve Connor, Science Editor Published: 25 August 2007
For more than a century it has been cited as the quintessential example of
Darwinism in action. It was the story of the peppered moth and how its two
forms had struggled for supremacy in the polluted woodlands of industrial
Britain.
Every biology textbook on evolution included the example of the black and
peppered forms of the moth, Biston betularia. The relative numbers of these
two forms were supposed to be affected by predatory birds being able to pick
off selectively either the black or peppered variety, depending on whether
they rested on polluted or unpolluted trees.
It became the most widely cited example of Darwinian natural selection and
how it affected the balance between two competing genes controlling the
coloration of an organism. Then the doubts began to emerge.
Critics suggested that the key experiments on the peppered moth in the 1950s
were flawed. Some went as far as to suggest the research was fraudulent,
with the implication that the school textbooks were feeding children a lie.
Creationists smelt blood. The story of the peppered moth became a story of
how Darwinism itself was flawed - with its best known example being based on
fiddled data.
Now a Cambridge professor has repeated the key predation experiments with
the peppered moth, only this time he has taken into account the criticisms
and apparent flaws in the original research conducted 50 years ago. Michael
Majerus, a professor of genetics at Cambridge University, has spent the past
seven years collecting data from a series of experiments he has carried out
in his own rambling back garden. It has involved him getting up each day
before dawn and then spending several hours looking out of his study window
armed with a telescope and notepad.
He wanted a definitive test of the idea that selective predation by birds
really was responsible for the differences in the chances of survival among
black and peppered varieties of B. betularia. His garden outside Cambridge
is in an unpolluted area so in this setting it should be the typical or
peppered variety of the moth that has a better chance of survival than that
of the black or carbonaria form; it is unlikely to be seen by birds against
the mottled background of the lichen-covered trees.
In a seminal description of his results to a scientific conference this week
in Sweden, Professor Majerus gave a resounding vote of confidence in the
peppered month story. He found unequivocal evidence that birds were indeed
responsible for the lower numbers of the black carbonaria forms of the moth.
It was a complete vindication of the peppered month story, he told the
meeting.
"I conclude that differential bird predation here is a major factor
responsible for the decline of carbonaria frequency in Cambridge between
2001 and 2007," Professor Majerus said.
"If the rise and fall of the peppered moth is one of the most visually
impacting and easily understood examples of Darwinian evolution in action,
it should be taught. It provides after all the proof of evolution," he said.
Criticisms of the 1950s experiments with the peppered month, carried out by
the Oxford zoologist Bernard Kettlewell, came to the fore in a 2002 book by
the American author Judith Hooper. Hooper's book, Of Moths and Men,
suggested that the scientists at the centre of these experiments set out to
prove the story irrespective of the evidence.
While the professor has also described drawbacks to Kettlewell's
methodology, he was able to address all of these concerns and even tested an
idea that Hooper had raised in her book - that it was bats rather than birds
responsible for moth predation - a suggestion he dismissed altogether.
Professor Majerus compiled enough visual sightings of birds eating peppered
moths in his garden over the seven years to show that the black form was
significantly more likely to be eaten than the peppered.
A statistical analysis of the results revealed a clear example of Darwinian
natural selection in action.
"The peppered moth story is easy to understand, because it involves things
that we are familiar with: vision and predation and birds and moths and
pollution and camouflage and lunch and death," he said. "That is why the
anti-evolution lobby attacks the peppered moth story. They are frightened
that too many people will be able to understand."
Natural selection in action
The peppered moth comes in two distinct, genetic varieties: the black,
melanic form (carbonaria) and the mottled form (typica). Against the
background of a lichen-covered tree growing in unpolluted countryside, the
typica form is well camouflaged. But in polluted areas where lichens do not
grow, it is the melanic form that is difficult to see.
The Victorian naturalist J W Tutt noted that 98 per cent of peppered moths
caught near Manchester at the end of the 19th century were the melanic
variety. He was the first to suggest that it was the result of higher
predation of typica by birds. With cleaner air in the late 20th century, it
was the turn of the melanic form to suffer from bird predation. Now it is
the typica form that is more common in most areas of Britain.
===
Nebraska Man Though not a deliberate hoax, the classification proved to be a
mistake. 
It was originally described by Henry Fairfield Osborn in 1922 on the basis of
a tooth found in Nebraska by rancher and geologist Harold Cook in 1917. 
Further field work on the site in 1925 revealed that the tooth was falsely
identified. Other parts of the skeleton were also found. According to these
newly discovered pieces, the tooth belonged neither to a man nor to an ape,
but to an extinct genus of Peccary called Prosthennops and its identification
as an ape was retracted in the journal Science in 1927.[1]
===
"HUMAN EVOLUTIONARY BIOLOGY: HUMAN ANATOMY AND PHYSIOLOGY FROM AN
 EVOLUTIONARY PERSPECTIVE" by Arndt von Hippel, M.D.: A review of life's
 layered progression from bacterium to nucleated cell to multicellular
 organisms shows how inadvertent information transfers and accidental mergers
 of desperately competing life forms brought about important advances.
 (von Hippel's other books include: "IN DARWIN'S IMAGE" and "AN
 EVOLUTIONIST DECONSTRUCTS CREATIONISM.")
===
Cosmic Cockroaches
August 31, 2007: Starved. Stomped. Radiated. Poisoned. It's all in a day's
work for the common household cockroach. The abuse these creatures can
withstand is amazing.
But astronomers have found something even tougher"polycyclic aromatic
hydrocarbons," says Achim Tappe of the Harvard Center for Astrophysics. "They
can survive a supernova."
Polycyclic aromatic hydrocarbons (PAHs for short) are ring-shaped molecules
made of carbon and hydrogen. They're about as well loved as roaches: PAHs are
a widespread organic pollutant, appearing in auto exhaust, oil spills and
cigarette smoke. The EPA has classified seven PAH compounds as human
carcinogens.
But even PAHs have their virtues: Ring-shaped molecules similar to PAHs are
found in DNA, and there's a growing consensus among biologists that PAHs were
present on Earth 4.5 billion years ago when life began. By serving as building
blocks for larger molecules of life, PAHs may have played an essential role in
the chemical process of genesis.
That's why Tappe's recent discovery may be so important.
The story begins 3000 years ago when
a massive star in the Large Magellanic Cloud exploded. It was, in most
respects, a typical supernova explosion, releasing in a just few days the
energy our sun produces in about 10 billion years. Hot gas and deadly
radiation blasted through nearby star systems, while the exploding star itself
was mostly (and perhaps completely) destroyed.
The supernova's expanding shell, catalogued by astronomers as "N132D", remains
visible from Earth after all these years. It spans 80 light years and has swept
up some 600 Suns worth of mass. Images from the Chandra X-ray Observatory
reveal the still-hot outlines--see the diagram below.
Last year "we scanned N132D using the Spitzer Space Telescope," says Tappe.
Spitzer is an infrared (IR) telescope, and it has a spectrometer onboard
sensitive to the IR emissions of PAHs. One look at N132D revealed "PAHs all
around the supernova's expanding shell. They appear to be swept up by a shock
wave of 8 million degree gas. This is causing some damage to the molecules,
but many of the PAHs are surviving."
Astronomers have long known that PAHs are abundant not only on Earth but
throughout the cosmosthey've been found in comet dust, meteorites and many
cold interstellar cloudsbut who knew they were so tough? "This is our first
evidence that PAHs can withstand a supernova blast," he says.
Their ability to survive may be key to life on Earth. Many astronomers are
convinced that a supernova exploded in our corner of the galaxy 4-to-5 billion
years ago just as the solar system was coalescing from primitive interstellar
gas. In one scenario of life's origins, PAHs survived and made their way to
our planet. It turns out that stacks of PAHs can form in waterthink,
primordial seasand provide a scaffold for nucleic acids with architectural
properties akin to RNA and DNA.
"It's an exciting and promising theory," says Tappe. "But more experiments and
observations are needed to decide its ultimate success or failure." Tappe is
doing his part with a new round of Spitzer observations: "We're mapping the
distribution of PAHs around N132D, comparing the locations of the molecules to
the arc of shock waves revealed by Chandra," he explains. From this "we hope to
learn how PAHs are 'processed' by the blast, and how many survive."
In the end, PAHs may prove tough enough for genesis itself. Cockroaches, eat
your hearts out.
==
Egypt Wadi el-Hitan contains fossils of the extinct suborder of whales, the
archaeoceti, that date back about 40 million years. UNESCO says the
fossils show the evolution of the whale from a land-based mammal to an
ocean-based one.
UNESCO declared the site, discovered in 1936, a World Heritage site in 2005.
===
In work published last year, Dr. Thornton reported how his group reconstructed
an ancestral protein of two hormone receptors found in humans. The two, once
identical, diverged along different evolutionary paths. One is now part of the
stress response system; the other is involved in different biological
processes, including kidney function in many animals.
In the new study, the researchers determined the exact positions of more than
2,000 atoms in the ancestral hormone receptor. The receptor existed in animals
that lived more than 440 million years ago, before the last common ancestor of
people and sharks. Then the researchers examined what occurred during the next
20 million years -- before another split of the evolutionary tree that led to
bony fish. "That's the ancestor of you and a salmon," Dr. Thornton said.
In that time, one hormone receptor changed so that it bound most strongly to
cortisol, a stress hormone. Bony fish and people have this version, called a
glucocorticoid receptor. Sharks do not.
Of the glucocorticoid receptors that have been looked at in different species,
five specific mutations are always present and distinguish them from the
ancestral receptor. When the scientists introduced the five changes into the
ancestral protein, they expected that it would be transformed into a
glucocorticoid receptor.
Instead, the protein broke, unable to bind to any hormone.
On further investigation, the scientists found that two other mutations, which
had negligible effects by themselves, strengthened some of the protein's folds
so it could withstand the other five mutations. The researchers were also able
to show several sequences in which the seven mutations could have occurred
without the protein's functionality ever deteriorating.
Biologists often point out that evolution does not proceed through random
chance. Rather, the process of natural selection -- survival of the fittest --
ruthlessly weeds out mutations detrimental to the survival of a species.
But the findings of Dr. Thornton and his colleagues show that some aspects of
evolution do occur solely by chance. The two mutations that reinforced the
protein did not directly help the organism. So natural selection did not
particularly favor them. It was only by chance that they occurred and
persisted to set the groundwork for the other mutations.
ut the findings of Dr. Thornton and his colleagues show that some aspects of
evolution do occur solely by chance. The two mutations that reinforced the
protein did not directly help the organism. So natural selection did not
particularly favor them. It was only by chance that they occurred and
persisted to set the groundwork for the other mutations.
Other seemingly innocuous mutations might have led evolution down another
path. These very exquisitely adapted bodies we have represent a role of the
dice, Dr. Thornton said. And they could have turned out very differently.

http://www.sciencemag.org/cgi/content/abstract/1142819
==
Scientists discovered archaea fossils in Ontario that date back
some 2.7 billion years and show the organism coexisted with life's two other
known domains, bacteria and eukaryotes. 
The oldest dated zircons date from about 4.4 Billion years ago - very close
to the hypothesized time of the Earth's formation. The Greenland sediments
include banded iron beds. They contain possibly organic carbon and quite
possibly indicate that photosynthetic life had already emerged at that time.
The oldest known fossils (from Australia) date from a few hundred million 
years later.
==
Douglas Hofstadter's most recent book, "I Am a Strange Loop"
==
Egypt discovers what may be oldest human footprint
 Egyptian archaeologists have found what they said could be
the oldest human footprint in history in the country's western desert, the
Arab country's antiquities' chief said on Monday.
"This could go back about two million years," said Zahi Hawass, the secretary
general of the Egyptian Supreme Council of Antiquities. "It could be the most
important discovery in Egypt," he told Reuters.
Archaeologists found the footprint, imprinted on mud and then hardened into
rock, while exploring a prehistoric site in Siwa, a desert oasis.
Scientists are using carbon tests on plants found in the rock to determine its
exact age, Hawass said.
Khaled Saad, the director of prehistory at the council, said that based on the
age of the rock where the footprint was found, it could date back even further
than the renowned 3-million year-old fossil Lucy, the partial skeleton of an
ape-man, found in Ethiopia in 1974.
Most archaeological interest in Egypt is focused on the time of the pharaohs.
Previously, the earliest human archaeological evidence from Egypt dated back
around 200,000 years, Saad said.
==
Fossil sea spiders thrill experts
The fossils from France are 160 million years old
A cache of exceptionally well-preserved fossil sea spiders has been described
for the first time.
The eight-legged marine animals, which are known as pycnogonids, are only
distantly related to land spiders.
The stunning specimens were discovered in 160 million-year-old fossil beds at
La Voulte-sur-Rhone, near Lyon in south-eastern France.
Details of the finds are published in the journal Proceedings of the Royal
Society B.
Sea spiders are still with us today; scientists have described about 1,300
species of pycnogonid. They are characterised by eight extremely long legs and
a prominent mouthpart.
While they may resemble land spiders, the pycnogonids form a distinct
biological group.
Writing in Proceedings B, Sylvain Charbonnier from the University of Lyon,
France, and colleagues say the new fossils fill a 400 million-year gap in our
knowledge of these enigmatic creatures.
The team identified 70 sea spiders from three distinct species in rock slabs
from the Jurassic La Voulte Lagerstatte. A Lagerstatte is a sedimentary rock
bed rich in fossils or containing well-preserved specimens.
"This Lagerstatte is very important because during Jurassic times the water
here was about 200m deep," Mr Charbonnier told the BBC News website.
Many other Lagerstatten from the Mesozoic - the era of the geological time
when the dinosaurs walked the Earth - were formed from lagoons or relatively
shallow bodies of water. This means that La Voulte Lagerstatte preserved many
fossil creatures not found elsewhere.

Scientists have painstakingly recreated an ancient sea spider from the faint
imprint it left when it fossilised around 425 million years ago.
The virtual reconstruction sheds new light on a debate about whether sea
spiders sit in the same biological family as true spiders and scorpions.
The presence of pincers suggests it does, a UK-US team claims in Nature.
This has previously been difficult to determine because the animals' delicate
bodies do not fossilise very well.
Living sea spiders are small marine arthropods with slender, segmented bodies,
a proboscis and four pairs of spindly legs.
The fossil sea spider Haliestes dasos lived in an ancient sea that covered the
area now known as Herefordshire, England, during the Silurian Period.
An eruption that carpeted the area in volcanic ash was responsible for the sea
spider's spectacular, three-dimensional preservation.
Owing to this fortuitous event, Haliestes avoided being flattened or
decomposing, leaving a perfect record of its form in the Herefordshire rocks.
But in order to bring that form to life, scientists from the Universities of
Oxford and Leicester, UK, and Yale in the US had to destroy the fossil itself.
"The rock itself is quite calcareous so we can't extract the fossil from the
rocks using any mechanical or chemical techniques," co-author Professor David
Siveter of the University of Leicester told BBC News.=
"The composition of the fossil as it's preserved and the composition of the
rock matrix in which it sits is similar. So there's very little difference to
play on. We can't, for example, use acid etching techniques."
The researchers used a machine that shaves off layers of the fossil at very
fine intervals of between 20 and 30 microns. To get an idea of just how fine
this is, one micron is equivalent one-thousandth of a millimetre.
After the machine grinds off a new slice of the fossil, the team took a
digital photograph of the fossil.
"We capture all of the morphology of the fossil digitally and then we use
computer techniques to reconstruct the animal.
"Although you might use the word reconstruct, what you've got is a real
animal. It's not part of someone's imagination."
Sea spiders are so rarely preserved that there are only a handful of specimens
in the fossil record. Haliestes is a complete specimen and an adult, which can
tell scientists a lot about where ancient and modern sea spiders sit in the
tree of life.
One theory had proposed that the pycnogonids (the technical name for the sea
spiders) were only distantly related to the chelicerates - the biological
grouping which includes true spiders, scorpions and horseshoe crabs.
But the presence of chelicera - or pincers - is exclusive to the chelicerates,
say the researchers. This, they claim, suggests the pycnogonids are full
members of that group.
A 2001 study in Nature combined genetic data with physical characteristics to
reconstruct a family tree of arthropods - the umbrella grouping that covers
sea spiders and chelicerates as well as crustaceans and insects.
This study supported a more distant relationship between pycnogonids and
chelicerates.
Dr Ward Wheeler, curator of invertebrate zoology at the American Museum of
Natural History in New York and co-author of the 2001 study, praised the
latest research but was cautious in drawing conclusions about the creatures'
evolutionary relationships.
"Pycnogonids have features that would lead to kinship with chelicerates, like
their [pincers] of course," Dr Wheeler told BBC News.
"Certain DNA features are very much like those of spiders and horseshoe crabs.
But there are other features that are not.
"In order to get a more stable, robust result, we're going to have to get an
analysis that includes extinct biological lineages as well as living ones and
includes morphological and molecular information."
The name Haliestes dasos means "hairy-rump soothsayer of the sea".
===
Darwinian Fairytales: Selfish Genes, Errors of Heredity, and Other Fables 
of Evolution (Paperback)     by David Stove  Pro-evolution

Two Great Truths: A New Synthesis of Scientific Naturalism and Christian
Faith by David Ray Griffin 

Midgley's "Darwinism as a Religion"

Polanyi's "Science, Faith, and Society.
==
The fact is that all great apes make & use tools, as do many other animals. In
the human lineage, our ancestors with slightly larger brains per body weight
than chimps started making stone tools some 2.5 million years ago. In a
positive feedback system, it appears that the stone tools gave us access to
more animal fat, which in turn allowed our brains to grow larger & more
complex, which led to more advanced tool use, although at the H. erectus level
of development, tool design seems to have stagnated for about a million years.
===
Alien life from dust particles?
Its not what life is supposed to be made of. Its definitely not where life is
supposed to be found. Yet it looks pretty alive, researchers say: it sustains
itself, reproduces itself, interacts with its neighbors and evolves.
Its a mere computer simulation of dust, of a type similar to that which floats
among stars, according to the scientists.
The investigators described the strange simulated dustwhich takes on the form
of corkscrewshaped particlesin a paper published today in the New Journal of
Physics. The findings hint at the possibility that life beyond earth may not
necessarily use carbonbased molecules as its building blocks, as it does on
Earth, they said. But the research also points to a possible new explanation
for life on our planet, they added.
Life on Earth consists of organic molecules, which are simply large compounds
of carbon. The notion that inorganic, or noncarbon based, dust may take on
life is nothing short of alien. The stuff doesnt even contain silicon, which a
few scientists have suggested could replace carbon as a building block for life
(even that idea is mostly relegated to science fiction today.)
In the new research, scientists at the Russian Academy of Science in Moscow,
the MaxPlanck Institute for Extraterrestrial Physics in Garching, Germany and
the University of Sydney, Australia, studied mixtures of inorganic materials
in a plasma.
Plasma is a gaslike substance whose atoms are stripped of the electrons, or
electrically charged particles, that normally inhabit them. This separation
leads the atoms to also become charged, because under normal conditions, the
electrons charge cancels out that of the atom. Plasma is considered a fourth
state of matter beyond solid, liquid and gas.
Until now, physicists assumed that there could be little organisation in such
a cloud of particles. However, The Russian Academys V.N. Tsytovich and
colleagues found, using a computer model of molecular dynamics, that plasma
particles can undergo selforganization as charges become separated. This
results in microscopic strands of solid particles that twist into corkscrew
shapes, or helical structures. These helical strands are themselves charged
and are attracted to each other.
Quite bizarrely, not only do these helical strands interact in a surprising
way in which like can attract like, they also undergo changes normally
associated with biological molecules, such as DNA and proteins, say the
researchers. They can, for instance, divide, or bifurcate, to form two copies
of the original structure. These new structures can also interact to induce
changes in their neighbours and they can even evolve into yet more structures
as less stable ones break down, leaving behind only the fittest structures in
the plasma.
So, could helical clusters formed from interstellar dust be somehow alive?
These complex, selforganized plasma structures exhibit all the necessary
properties to qualify them as candidates for inorganic living matter, said
Tsytovich, they are autonomous, they reproduce and they evolve.
He adds that the plasma conditions needed to form these helical structures are
common in outer space. However, plasmas can also form under more down to earth
conditions such as the point of a lightning strike. The researchers hint that
perhaps an inorganic form of life emerged on the primordial earth, which then
acted as the template for the more familiar organic molecules we know today.
===
Common descent means that life forms show signs of
descent from a common ancestor. All organisms studied
so far show descent from the last universal common
ancestor, although some workers think that this
ancestor may have been a gene pool united by lateral
gene transfer rather than a specific single organism.

Artificial selection, as you must know, is nothing
more than human selective breeding of plants, animals
& other organisms. Darwin discovered & named natural
selection by analogy with this process, although the
selection is by differential reproductive success in
nature.

Random variation is one source of genetic material
upon which natural selection may work to produce new
species. Some mutations are adaptive, ie bestow a
competitive advantage on the individual in which they
arise, so that its genes increase in the next
generation (increasing its "fitness"), but of course
most mutations are deleterious.

Punctuated equilibrium is a theory about the rate &
pace of evolution, or tempo & mode, proposing that
sexual species don't change much over most of their
"life" spans. It's probably not a consensus
hypothesis, but in any case doesn't, as you seem to
think, in any way "disprove" natural selection working
on genetic variation. According to the theory,
sexaully reproducing organisms undergo spurts of
speciation, then stay pretty much the same until
extinction or evolution into new forms, subject of
course to genetic drift & other phenomena. But this
really isn't anything new. Traditional evolutionary
thought recognizes that environmental changes &
isolating mechanisms can drive adaptive radiations.* **

Hox systems are one set of common genes in animals
that organize their development, in this case axial
patterning. There are many others in various phyla
(plants use a different system, although elements of
it are present in animals, as I think versions of Hox
are in plants, but not sure about this), although Hox
systems may be particularly well studied.***

Hahn and his colleagues set out to study these gains
and losses in gene number over the millennia by
examining the genomes of humans, chimps, mice, rats
and dogs. They looked at 110,000 genes that fall into
9,990 different families of similar genes. 

The size of a gene family differed between species in
5,622 cases, or 56 percent of all the families. These
size changes are so frequent in the evolutionary
history of mammals that genes might as well be going
through a revolving door, the researchers write in a
paper published in a new online journal, PLoS ONE. 

In humans and chimps, which have about 22,000 genes
each, the group found 1,418 duplicates that one or the
other does not possess. For example, humans have 15
members of a family of brain genes linked to autism,
called the centaurin-gamma family, whereas chimps have
six, for a difference of nine gene copies. 

The group estimated that humans have acquired 689 new
gene duplicates and lost 86 since diverging from our
common ancestor with chimps six million years ago.
Similarly, they reckoned that chimps have lost 729
gene copies that humans still have. 

"The paper supports the emerging view that change in
gene copy number, via gene duplication or loss, is one
of the key mechanisms driving mammalian evolution,"
says genomics researcher James Sikela of the
University of Colorado Health Sciences Center. End
Quote.

***You might also be interested to learn that rats &
mice also have about the same number of genes as
humans & chimps. I quote from a summary of a 2004
Nature paper on the NIH Rat Genome Sequencing Project,
led by principle investigator Dr. Richard Gibbs,
director of the Baylor College of Medicine's Genome
Sequencing Center.

The researchers reported that, at approximately 2.75
billion base pairs, the rat genome is smaller than the
human genome, which is 2.9 billion base pairs, and
slightly larger than mouse genome, which is 2.6
billion base pairs. However, they also found that the
rat genome contains about the same number of genes as
the human and mouse genomes. Furthermore, almost all
human genes known to be associated with diseases have
counterparts in the rat genome and appear highly
conserved through mammalian evolution, confirming that
the rat is an excellent model for many areas of
medical research.

Comparison of the rat genome to those of the human and
mouse also opens a new and unique window into
mammalian evolution. The rodent lineage, which gave
rise to the rat and mouse, and the primate lineage,
which gave rise to humans, diverged about 80 million
years ago. Humans have 23 pairs of chromosomes, while
rats have 21 and mice have 20. However, the new
analysis found chromosomes from all three organisms to
be related to each other by about 280 large regions of
sequence similarity, called "syntenic blocks",
distributed in varying patterns across the organisms'
chromosomes.

The sequence data also confirms that the rodent
lineage split 12 to 24 million years ago into the
separate lines that gave rise to the rat and to the
mouse. Researchers estimate about 50 chromosomal
rearrangements occurred in each of the rodent lines
after divergence from their common ancestor. The
number of chromosomal rearrangements, as well as other
types of genome changes, was found to be much lower in
the primate lineage, indicating that evolutionary
change has occurred at a faster rate in rodents than
in primates.

The new analysis also underscores the fact that while
rats and mice look very similar to the human eye,
there are significant genomic differences between the
two types of rodents. For example, some aspects of
genomic evolution in the rat appear to be accelerated
when compared to the mouse. According to the new
analysis, due to the unusually rapid expansion of
selected gene families, rats possess some genes not
found in the mouse, including genes involved in
immunity, the production of pheromones (chemicals
involved in sexual attraction), the breakdown of
proteins and the detection and detoxification of
chemicals.

Duplications constitute an important source of
genetic material upon which natural selection may
work, along with other "mutations", such as somewhat
random insertions & deletions in the genetic code
(although evolution also, as noted in this group
protects some areas while encouraging changes
elsewhere in the genome).***

==
Based on what we can discern of their culture, Neanderthals weren't smarter 
than H. sapiens sapiens, ie we. Some paleoanthroplogists & archaeologists
credit Neanderthals with Aurignancian (or Chatelperronian) culture, but not
very convincingly, given dating problems. There's also controversy over
their burial practices, if any. Not only their stone-working technologies, but
their hunting methods were clearly inferior to anatomically modern humans'.
They probably had fairly sophisticated verbal communication of some kind, but
many specialists think their anatomy didn't allow them to make certain sounds
key to modern language. Their brains were generally bigger, but shaped
differently. Size could just be related to their greater physical
bulk. They were enormously strong, compared to their African & Asian immigrant
cousins, ie us. Whether Neanderthals were more intelligent than modern
humans is an interesting topic on which to speculate. More than anything else,
the key point that I was trying to make is that intelligence by itself,
without regard to other characteristics, will NOT necessarily make
an organism better adapted than less intelligent organisms. In other words, if
it ever is shown that Neanderthals were indeed more intelligent than
modern humans, their extinction would not falsify evolution through natural
selection.
==
Eye
The photoreceptors (rods and cones) MUST face AWAY
from the front of the eye in order to be in contact with the pigment
epithelium on the choroid, which supply it with blood.  This is a serious
problem because rods and cones need an enormous amount of energy for repair
and they completely replace themselves at a very high rate (about every 7
days or so), due to phototoxicity, and other damage.  
===
Pennock "Tower of Babel"

Evolution as a Religion by Mary Midgley 

Evolution Under the Microscope by David W. Swift 

Two Great Truths: A New Synthesis of Scientific Naturalism and Christian Faith
by David Ray Griffin 

The Triumph of Evolution and the Failure of Creationism by Niles Eldredge.
==
Fossils paint new picture of human evolution
- An ancient skull and upper jawbone from two early branches
of the human family tree -- Homo erectus and Homo habilis -- suggest the early
human ancestors may have lived close together for half a million years,
researchers said on Wednesday.
The fossils, discovered in eastern Africa, challenge the understanding that
humans evolved one after another like a line of dominoes, from ancient Homo
habilis to Homo erectus and eventually to Homo sapiens, or modern people.
"There has been a view that has suggested habilis very slowly evolved into
erectus," said Susan Anton, a professor of anthropology at New York
University. "Now we have the two cohabitating, so that can no longer be the
case."
The research, published in the journal Nature, was conducted by nine
scientists including Anton, paleontologist Meave Leakey and her daughter
Louise Leakey, both explorers in residence at the National Geographic Society,
and Fred Spoor of University College London.
Both fossils were found in 2000 east of Lake Turkana in Kenya as part of the
Koobi Fora Research Project, which is affiliated with the National Museums of
Kenya.
Their proximity suggests the two species used different food sources and
behaviors to live so closely without becoming extinct.
"It's within two or three minutes walking distance," said Patrick Gathogo, a
doctoral candidate from the University of Utah who helped study the geological
layers.
"They must have interacted with each other," he said in a telephone interview.
SISTER SPECIES
The upper jaw bone of Homo habilis dates from 1.44 million years ago, which is
earlier than other known fossils of that species.
"The new fossil jaw suggests that Homo habilis was a sister species of Homo
erectus, living at broadly the same time, rather than the mother species
giving rise to it," Spoor said in a statement.
The second fossil, found in the same region of northern Kenya, is a
well-preserved skull of Homo erectus, which dates from about 1.55 million
years ago.
This fossil is striking because of its size. It is the smallest Homo erectus
skull found so far and it paints a different picture of the species,
suggesting more diversity than researchers had believed.
This diversity could mean that like gorillas, in which males have much larger
skulls than females, Homo erectus might have exhibited sexual dimorphism, a
primitive trait, the researchers said.
Reduced size differences between the sexes is typically considered a trait
acquired during human evolution.
"It makes Homo erectus a bit less like us," Anton said.
Spoor said all available evidence still suggests that Homo sapiens evolved
from Homo erectus, a process that happened in Africa more than 1 million years
ago.
He said it is likely the two species will have had a common ancestor living in
Africa between 2 million and 3 million years ago.
 
==
New Fossils Support Deep-Sea Origin of Life
Geologists have discovered 1.43 billion-year-old fossils of deep-sea microbes,
providing more evidence that life may have originated on the bottom of the
ocean.
The ancient black smoker chimneys, which scientists unearthed in a Chinese
mine, are 1 billion years older than similar fossils previously identified and
are nearly identical to the archaea- and bacteria-harboring structures found
today on sea beds.
"These are remnants of the oldest living types of life forms on the planet,"
said Timothy Kusky, a geologist at Saint Louis University and co-author of a
new study that describes the fossils.
Kusky said that the fossils offer "tantalizing suggestions" that life
developed near deep-sea hydrothermal vents and not in shallow seas, as other
evidence hints.
Black smoker chimneys develop at submerged openings in the Earth's crust that
spew out mineral-rich water as hot as 752 degrees Fahrenheit (400 degrees
Celsius). Bacteria that don't depend on sunlight or oxygen move into the
fragile chimneys that grow around the vents and feed on the dissolved minerals.
"Some people like to call it life in extreme environments. These bacteria
pretty much live on a different planet compared to conditions we live in,"
Kusky told LiveScience.
The stony chimneys can grow more 50 feet (15 meters) tall, but retrieving even
a modern chimney sample is extremely difficult, as they're fragile and can
crumble when touched.
"This discovery offers scientists valuable on-land samples for geological and
geo-biological research," Kusky said, noting that some of the fossils he
unearthed measure a whopping 3 feet in length.
The age and size of the chimneys, Kusky said, will help scientists understand
how ancient hydrothermal vent growth and the development of life on the sea
floor might be interconnected.
Although the fossils may be old, they aren't the oldest evidence of life on
Earth. The most ancient specimens are 3.5 billion-year-old, dome-shaped clumps
of bacteria called stromatolites, which were found in western Australia and
suggest that shallow seas were the birthplace of life.
Ed Mathez, a geologist and curator at the American Museum of Natural History
in New York who is not connected to the discovery, said even with
stromatolites the verdict on life's origin is out.
"They tell us life existed that long ago, but as to where it originated
remains an open question," Mathez said.
Mathez pointed out that black smoker fossils are just as inconclusive about
the origin of life , but added that the new finding significantly pushes back
the known reign of deep-sea microbes.
"Personally, a deep-sea origin of life strikes me as a very good possibility,"
he said.
In the end, Kusky said, there may yet be even older black smoker chimney
fossils waiting to be discovered.
"So far, these fossils provide oldest evidence for deep-sea life," he said.
His team's findings are detailed in the current issue of the journal Gondwana
Research.
==
Dinosaurs, early relatives coexisted
UC team's fossil find shows mysterious precursors stuck around longer than
previously thought
UC Berkeley scientists, digging deep into a remote New Mexico hillside, have
discovered a trove of fossil bones that they say is evidence that dinosaurs
and their early relatives lived side by side for tens of millions of years
before the relatives slowly died off and left the dinosaurs to dominate the
ancient world.
Until now many scientists had thought that dinosaur "precursors" -- perhaps
their ancestors -- disappeared suddenly long before the dinosaurs themselves
rose to prominence, but the bones dug up by Berkeley paleontologists show
evidence of a different story.
The discovery of a wide variety of creatures all mingled together in layer
upon layer of rocks dating from Earth's late Triassic period between 235
million and 200 million years ago, they say, shows that the strange relatives
of the dinosaurs remained on the scene while the dinosaurs evolved into truly
dominant creatures during the Jurassic period, between 120 million and 200
million years ago.
Until now, many scientists have argued that the early close relatives of
dinosaurs must have disappeared abruptly in an early "mass extinction" about
215 million years ago that has never been clearly explained. Others have
thought that the true dinosaurs, whether carnivores or plant eaters, simply
outcompeted their relatives for dominance in the ancient environment and
quickly drove them to extinction.
But the new findings show clearly that the disappearance of what noted
Berkeley paleontologist Kevin Padian calls "the dino wannabes" was a long,
very slow process.
The scene of this latest dinosaur discovery is New Mexico's fabled Ghost Ranch
-- a modest cluster of buildings in a spectacular landscape of mountains,
cliffs and canyons where Georgia O'Keeffe once lived and drew inspiration for
her paintings from the red-rock mesas and the stark, bleached animal skulls
strewn about the desert floor.
Two of Padian's graduate students, Randall Irmis at Berkeley and Sterling
Nesbitt, who is now working at the American Museum of Natural History, led the
dig for the past two years, and have recovered more than 2,300 fossil
specimens, from dinosaur thigh bones a foot long to microscopic fish scales. A
report on the team's discoveries is being published today in the journal
Science.
The fossils date from a time when all the continents of the world were massed
into one "supercontinent" now called Pangea -- long before the process of
continental drift began splitting Pangea into separate land masses -- and the
fossil site was then located at the equator.
"This is the first time anywhere that we've found dinosaurs together with
their closest relatives," said Padian, "and the dinosaurs obviously lived with
those guys for a long, long time."
Although Padian and his colleagues will not say that his wannabes are direct
ancestors of the dinosaurs, Anthony Fraser, a paleontologist at the Virginia
Museum of Natural History, thinks that's possible.
Fraser was not connected with the Berkeley fossil-hunting team, but in an
interview, he praised their work and the fossils they found. "Those guys are
surely on their way to being dinosaurs," he said of the mysterious dinosaur
precursors. "They're in the same lineage, at least, but we may never know
who's an ancestor of what."
Among Padian's wannabes -- collectively known as "basal dinosauromorphs" --
are the bones of a species that has never been seen before, but is clearly at
least an early relative of the dinosaur. The team has named it Dromomeron
romeri, and it may have been, according to Irmis, a two-legged animal and
probably a swift runner.
Another precursor relative puzzles the team completely because its fossilized
remains are so fragmentary. It may be a long-gone creature named silesaurus,
which was first identified when its bones were dug up in Poland about seven
years ago. Researchers believe it must have been a large reptile about 7 feet
long with a big, toothless beak, indicating it was probably a plant eater.
"It's very bizarre," says Irmis of his team's Ghost Ranch find.
Mixed with those fossils in the same rock layers are the bones of several
species of small true dinosaurs, none much larger than 6 feet long, the team
reports. Among them was one known as chindesaurus, a meat eater that ran
swiftly on two legs, and another related to the carnivorous dinosaur
coelophysis -- both reminiscent of the much later velociraptors, the vicious
pack hunters of "Jurassic Park."
All the fossils at Ghost Ranch are curious, if not bizarre, and among the
varied mix are the remains of amphibians that must have looked like frogs
crossed with crocodiles; beasts called "eagle lizards" with coats of heavy
armor plates; and the four-legged evolutionary ancestors of today's crocodiles
that are known to share a common ancestry with dinosaurs.
All these and more have come from the cutaway side of a hill at Ghost Ranch
called the Hayden Quarry, and the entire area around the site is marked by
other quarries where other scientists have found hundreds upon hundreds of
dinosaurs and their precursor relatives in different layers -- but never so
abundantly and so clearly side by side.
In fact, virtually all the Southwest, including much of New Mexico and
Arizona, is underlain by rocks called the Chinle Formation, where sedimentary
rocks were laid down by ancient rivers between 250 million and 200 million
years ago.
The Chinle Formation's rocks are a rich burial ground for countless groups of
long-extinct animals -- including mammals, lizards, crocodiles, turtles and
frogs -- and, pieced together, their bones will surely lead to more insights
into the evolution of many modern animals -- including the "modern dinosaurs"
alive today, known more prosaically as birds.
Irmis kept field notes of the team's most recent work at Ghost Ranch, which
ended only a month ago. "Relatively few people have concentrated on the origin
of the dinosaurs," he wrote. "Where did they come from? How did they diversify?
Why were they more successful than some of their early contemporaries? When did
dinosaurs first get big?"
==
Spelling Neanderthal
The letter 'h' was formerly used in many German words following 'T'.
the spelling reform of about 1901 changed many of these words. 'Thal'
was changed to 'Tal' in accordance with this reform. It means 'valley'.
of the Neander River.
==
The majority of investigators did not consider vascular plants to
have existed in Pre-Silurian times.
==
Scientists map elephant evolution
Scientists say they have calculated the date at which the African and
the Asian elephant went their separate ways.
The two elephant species diverged from a common ancestor some 7.6
million years ago, experts working in the US, Germany and Switzerland
say.
They came to their conclusion after comparing a genetic analysis of
the two species with material derived from the extinct woolly mammoth
and mastodon.
The African elephant is much bigger than its Asian counterpart.
It is known for its large, floppy ears, and both sexes have great
ivory tusks, unlike the Asian elephant where typically only the males
have large external tusks.
Tooth extract
The now extinct mastodon was very similar in appearance to the woolly
mammoth - with lots of hair and big tusks.
Genetically, however, it was very different and is only a distant
relative of the elephants.
Its genetic profile had not previously been mapped, but now thanks to
the analysis of material extracted from a fossilised tooth found on
the banks of an Alaskan river, scientists have the first genetic
portrait of the creature.
By comparing the mastodon's genetic map with existing genome
sequences for modern elephants and the woolly mammoth, they have
built up a family tree for the elephants.
The tree has the African elephants diverging from both the Asian
elephant and the mammoth about 7.6 million years ago.
Then, at 6.7 million years ago, the Asian elephant and the mammoth
also go their separate ways.
Human comparison
"The cool thing about the mastodon is that we know pretty exactly
from the fossil record when it diverged from the elephant and the
mammoth," said Dr Michael Hofreiter of the Max Planck Institute for
Evolutionary Anthropology in Leipzig, one of the lead researchers.
"So using that time point and the genetic data, we could date when
the African elephant, Asian elephant and mammoth diverged from each
other," Dr Hofreiter added.
==
Ornithologists recognize about 70 families of extant
birds & many more of extinct ones
===
Did Ancient Volcano Alter Human History?
An ancient volcanic super-eruption, one of the largest known in Earth's
history, may not have devastated the world and humanity as much as once
thought.
The eruption at what is now Lake Toba in the Indonesia island of Sumatra
roughly 75,000 years ago was the largest in the last 2 million years. This
gigantic blast released at least 7.7 trillion tons or 670 cubic miles of
magma, equivalent in mass to more than 19 million Empire State Buildings.
Vast plumes of ash stretched from the South China Sea to the Arabian Sea and
likely blotted out the sun and drastically cooled the Earth for yearsa
"volcanic winter." Scientists have suggested the environmental catastrophe
that might have resulted could have influenced the course of human history,
with people today evolving from the few thousand survivors of that disaster.
Indirect clues
Petraglia and his colleagues investigated deposits of ash from Toba more than
eight feet thick near the southern Indian village of Jwalapuram. They found
hundreds of stone blades and other tools just below and above this ash
layereffectively immediately before and after the eruptionthat are fairly
similar to each other. With the artifacts, they also found pieces of red
ochre, a mineral used for body art and cave drawings, as well as for helping
to stick tools together.
The artifacts appeared similar to some from modern humans dating to around the
same time period in Africa. These findings suggest humans continued to live in
the area after the blast.
"We would have had very mobile populations of hunter-gatherers here, able to
cope with all sorts of disasters," Petraglia told LiveScience. "If we were
talking about settled people with agriculture, the Toba super-eruption would
have been a cataclysm."
The research was detailed in the July 6 issue of the journal Science.
More evidence needed
Not everyone thinks the new evidence is convincing. Anthropological
archaeologist Stanley Ambrose at the University of Illinois at
Urbana-Champaign, who proposed that the Toba catastrophe influenced human
evolution, found the published data inadequate.
"The only way to prove their assertions is to find human skeletons below the
ash that look like Africans," Ambrose said.
Petraglia said they had "thousands more artifacts than we presented in the
paper" to support the new claim, but did agree that fossils would be
definitive proof. "We don't have human fossils, we don't have Neanderthal
fossils, we don't have any fossils. We'd love to find fossils," Petraglia said.
An exciting but controversial aspect of their findings is that modern humans
got out of Africa far earlier than was thought. "For the last 150 years,
archaeologists have concentrated on when modern humans got out of Africa into
Europe, but our findings suggest they might have gotten to India 30,000 years
before they got to Europe," Petraglia said.

Stanley Ambrose, an anthropologist at the University of Illinois, suggested in
1998 that Rampino's work might explain a curious bottleneck in human evolution:
The blueprints of life for all humans -- DNA -- are remarkably similar given
that our species branched off from the rest of the primate family tree a few
million years ago.
Ambrose has said early humans were perhaps pushed to the edge of extinction
after the Toba eruption -- around the same time folks got serious about art
and tool making. Perhaps only a few thousand survived. Humans today would all
be descended from these few, and in terms of the genetic code, not a whole lot
would change in 74,000 years.
==
Humans walk upright to conserve energy
 Why did humans evolve to walk upright? Perhaps because it's just
plain easier. Make that "energetically less costly," in science-speak, and you
have the conclusion of researchers who are proposing a likely reason for our
modern gait.
Bipedalism  walking on two feet  is one of the defining characteristics of
being human, and scientists have debated for years how it came about. In the
latest attempt to find an explanation, researchers trained five chimpanzees to
walk on a treadmill while wearing masks that allowed measurement of their
oxygen consumption.
The chimps were measured both while walking upright and while moving on their
legs and knuckles. That measurement of the energy needed to move around was
compared with similar tests on humans and the results are published in this
week's online edition of Proceedings of the National Academy of Sciences.
It turns out that humans walking on two legs use only one-quarter of the
energy that chimpanzees use while knuckle-walking on four limbs. And the
chimps, on average, use as much energy using two legs as they did when they
used all four limbs.
However, there was variability among chimpanzees in how much energy they used,
and this difference corresponded to their different gaits and anatomy.
One of the chimps used less energy on two legs, one used about the same and
the others used more, said David Raichlen, assistant professor of anthropology
at the University of Arizona.
"What we were surprised at was the variation," he said in a telephone
interview. "That was pretty exciting, because when you talk about how
evolution works, variation is the bottom line, without variation there is no
evolution."
If an individual can save energy moving around and hunting and spend more of
it on reproduction, "that's how you end up getting new species," he said.
Walking on two legs freed our arms, opening the door to manipulating the
world, Raichlen said. "We think about the evolution of bipedalism as one of
first events that led hominids down the path to being human."
Theirs is the latest of several explanations for walking upright. Among the
others have been the need to used the arms in food gathering, the need to use
the upper limbs to bring food to a mate and offspring and raising the body
higher to dissipate heat in the breeze.
==
Blame that bad back on your ancestors
A spine specialist trying to figure out why people so
often have bad backs says he has come up with a new theory about when and how
early humans evolved the ability to walk upright.
The uncannily human-looking backbone of a 21 million-year-old precursor of
humans and apes gives the first clue, said Dr. Aaron Filler of the Cedars
Sinai Medical Center in Los Angeles.
A major change in the vertebrae that allowed this pre-human to stand upright
and carry things also made it easier to crush and strain the spongy discs
between each vertebra, Filler, a medical doctor with a doctorate in
anthropology proposes.
That, in turn, explains why back pain is a leading cause of disability, he
said.
Writing in the journal Neurosurgical Focus on Sunday, Filler said one main
clue was a bone feature called the transverse process, which sticks out from
the side of the hollow, round vertebrae, Filler said in a telephone interview.
This is where muscles attach to the spine.
"The vertebra is transformed in a way that literally reverses the mechanics of
the spine," Filler said. "The bone lever of the vertebrae gets switched from
bending the spine forward to bending the spine back."
Most vertebrates are oriented forward, to walk on all fours. The transverse
process is at the front of each vertebra, facing the animal's belly. This is
true of monkeys, too.
But in humans and in the 21 million-year-old fossil of a creature called
Morotopithecus bishopi, a tree-dwelling, ape-like creature that lived in what
is now Uganda, the transverse process has moved backward, behind the opening
for the spinal cord.
Great apes, such as chimpanzees, share this feature.
'THE UPRIGHT APE'
The fossil was discovered in the 1960s but no one noticed the important change
until 1997, when paleontologist Laura MacLatchy of the State University of New
York at Stony Brook reported on the remarkable features of Morotopithecus.
"That means that upright posture bipedalism goes back 20 million years, not
just 5 or 6 million years," said Filler.
In his study and in a book published last week called "The Upright Ape -- a
new origin of the Species," Filler argues that this common ancestor, and
ancestors going back many millions of years before, walked upright. Homo
sapiens, the human species, continued upright, while apes evolved back toward
all fours, he argues.
"When you look at most ape species, their spines and most of their bodies
still look pretty monkey-like," Filler said.
He also said humans evolved a new structure of muscles that pull the body from
side to side while standing.
"This is very important for carrying an infant or child," Filler said. "From
the point of view of back pain, now we have big muscles doing this heavy work
that never did before. They can get torn and strained."
The backward orientation also allows the cushiony discs to get crushed, Filler
said. "In most animals the vertebrae get spread apart when they carry infants
on their backs when on all fours," he said.
What further differentiates humans from apes is the positioning of the place
where the spine attaches to the hips, said Filler, who dissected the backbones
of dead gibbons, chimpanzees and macaque monkeys and compared them to bones
from living and extinct species of other animals and fossils from various
pre-humans.
==
Blame that bad back on your ancestors
A spine specialist trying to figure out why people so
often have bad backs says he has come up with a new theory about when and how
early humans evolved the ability to walk upright.
The uncannily human-looking backbone of a 21 million-year-old precursor of
humans and apes gives the first clue, said Dr. Aaron Filler of the Cedars
Sinai Medical Center in Los Angeles.
A major change in the vertebrae that allowed this pre-human to stand upright
and carry things also made it easier to crush and strain the spongy discs
between each vertebra, Filler, a medical doctor with a doctorate in
anthropology proposes.
That, in turn, explains why back pain is a leading cause of disability, he
said.
Writing in the journal Neurosurgical Focus on Sunday, Filler said one main
clue was a bone feature called the transverse process, which sticks out from
the side of the hollow, round vertebrae, Filler said in a telephone interview.
This is where muscles attach to the spine.
"The vertebra is transformed in a way that literally reverses the mechanics of
the spine," Filler said. "The bone lever of the vertebrae gets switched from
bending the spine forward to bending the spine back."
Most vertebrates are oriented forward, to walk on all fours. The transverse
process is at the front of each vertebra, facing the animal's belly. This is
true of monkeys, too.
But in humans and in the 21 million-year-old fossil of a creature called
Morotopithecus bishopi, a tree-dwelling, ape-like creature that lived in what
is now Uganda, the transverse process has moved backward, behind the opening
for the spinal cord.
Great apes, such as chimpanzees, share this feature.
'THE UPRIGHT APE'
The fossil was discovered in the 1960s but no one noticed the important change
until 1997, when paleontologist Laura MacLatchy of the State University of New
York at Stony Brook reported on the remarkable features of Morotopithecus.
"That means that upright posture bipedalism goes back 20 million years, not
just 5 or 6 million years," said Filler.
In his study and in a book published last week called "The Upright Ape -- a
new origin of the Species," Filler argues that this common ancestor, and
ancestors going back many millions of years before, walked upright. Homo
sapiens, the human species, continued upright, while apes evolved back toward
all fours, he argues.
"When you look at most ape species, their spines and most of their bodies
still look pretty monkey-like," Filler said.
He also said humans evolved a new structure of muscles that pull the body from
side to side while standing.
"This is very important for carrying an infant or child," Filler said. "From
the point of view of back pain, now we have big muscles doing this heavy work
that never did before. They can get torn and strained."
The backward orientation also allows the cushiony discs to get crushed, Filler
said. "In most animals the vertebrae get spread apart when they carry infants
on their backs when on all fours," he said.
What further differentiates humans from apes is the positioning of the place
where the spine attaches to the hips, said Filler, who dissected the backbones
of dead gibbons, chimpanzees and macaque monkeys and compared them to bones
from living and extinct species of other animals and fossils from various
pre-humans.
==
Ancient Jawbone Could Shake Up Fossil Record
Jawbones from an early human ancestor, found recently in northeast Ethiopia,
could shine light on a murky period of human evolution, paleontologists say.
The bones were found in the fossil-rich Afar region, just 20 miles (32
kilometers) north of the spot where the famed skeleton of "Lucy"early human
ancestor who lived 3.2 million years agowas unearthed in 1974. (What was Lucy?)
The new bones are believed to date from 3.8 million to 3.5 million years ago.
Though more research needs to be done, the group says the bones could bridge
the gap between two known human ancestor species.
Australopithecus anamensis lived some 4.2 million to 3.9 million years ago,
and Australopithecus afarensisthe species to which Lucy belongedthrived from
3.6 million to 3 million years ago. (Explore our human roots through the
Genographic Project.)
Some researchers believe that Lucy and others of her species were descendants
of A. anamensisand these new Ethiopian jawbones could end that speculation.
"This will help us test this very hypothesis and see if we can falsify it or
prove it," said Yohannes Haile-Selassie, one of the lead researchers on the
project and head of physical anthropology at the Cleveland Museum of Natural
History in Ohio.
"We have had isolated teeth and [other skeleton parts] from previous years.
What we didn't have was a complete jaw, which we have now," he said.
Along with the jawbone, the team has also uncovered more than 30 or 40
specimens to further test the hypothesis, Haile-Selassie noted.
====
When scientists recently announced that they'd successfully replaced the
genome of one bacteria species with another, it was a key step forward for the
emerging field of synthetic biology.
The technique the J. Craig Venter Institute researchers used adds to the
rapidly growing body of work by synthetic biologists who are designing genes
and other cellular parts. They plan to custom-make microbes that can
manufacture drugs, boost crops, clean up pollution and even generate fuel.
==
http://groups.yahoo.com/group/creationis m/files/Stochastic%20Innovation.pdf 
Origin of life chemistry
==
The giant order Passeriformes includes more than half of all bird
species. Sometimes known as perching birds or, less accurately, as songbirds,
the passerines form one of the most spectacularly diverse terrestrial
vertebrate orders: with around 5,400 species, it is roughly twice
as diverse as the largest of the mammal orders, the Rodentia.
==
Starfish, sequoias, salamanders, and the rest of Earth¹s residents seem very
diverse. But they¹re surprisingly similar on the molecular scale. Every species
scientists have studied needs liquid water to survive, for example. They all
rely on DNA to carry genetic information. They all use that information to
build proteins from the same set of building blocks, known as amino acids. 
When we look in the universe, the only compounds we see with more than six
atoms are all carbon chemistry,²
³There is good evidence that the life we know on Earth was preceded by a weird
form of life,² said Dr. Benner. Early Earth life may have been based on RNA, a
single-stranded form of DNA. While DNA-based life may have outcompeted earlier
forms on the surface of the planet, RNA life may still exist in refuges.
===
Humans have a nature need for authority figures, being a
social animal. This can be seen in many other social animals. When
man looks to himself and sees that there are many in authority, he
naturally tends to ask from where this authority comes. When one reachs
the top of this structure for man, he must accept that there is no
more ultimate authority, or proceed to invent them. Man's natural
tendency towards authority is paramount.
You can see this in nature, each lion with his territory has
his pride. Each bird contends for the best nesting place. Only
alpha pairs mate when this is seen in wolves. Where is the
territory, where do they nest, who gets to mate? It depends on the social
hierachy that has been established not by the hand of a god, but by
the animals themselves.
===
Million-year-old human tooth found in Spain
Spanish researchers on Friday said they had unearthed a human tooth more than
one million years old, which they estimated to be the oldest human fossil
remain ever discovered in western Europe.
Jose Maria Bermudez de Castro, co-director of research at the Atapuerca site
said the molar, discovered on Wednesday in the Atapuerca Sierra in the
northern province of Burgos, could be as much as 1.2 million years old.
"The tooth represents the oldest human fossil remain of western Europe. Now we
finally have the anatomical evidence of the hominids that fabricated tools more
than one million years ago," the Atapuerca Foundation said in a statement.
"Since it is an isolated fossil remain, it is not possible at this point to
confirm which Homo species this tooth belongs to," the foundation added, but
said first analyses "allow us to suppose it is an ancestor of Homo antecessor
(pioneer)."
In 1994 at the nearby Gran Dolina site several Homo antecessor fossils were
uncovered, suggesting human occupation of Europe around 800,000 years ago,
whereas scientists had previously believed the continent had only been
inhabited for around half a million years.
Subsequent findings in various sites across Spain lent further credence to the
earlier date.
The Sierra Atapuerca contains several caves such as the Gran Dolina site,
where fossils and stone tools of Europe's earliest known hominids have been
found.
Researchers found the molar in the Sima del Elefante section of the sierra
which had previously yielded fossils from mammals including bison, deer and
bear as well as birds and a mouse.
The foundation said studies of the geological level suggested it was more than
one million years old but that final results were being awaited prior to
"publishing this extraordinary finding in a research journal of the highest
scientific prestige."
Bermudez de Castro, one of three paleontologists leading the expedition, said
the fossil appeared to be "well worn" and from an individual aged between
20-25.
"For the time being we have no idea what species but there is no doubt, from
the (geological) level where the tooth was found, that it belonged to the
oldest European found to date," he added.
Excavations in recent years in the sierra have uncovered human remains ranging
from early humans through the Bronze Age to modern man.
Atapuerca's most famous site is "Sima de los Huesos" (pit of bones) and
fossils found there date from at least 350,000 years ago.
==
Behe's own department of biological sciences at Lehigh University, has
publicly disowned him, via a remarkable disclaimer on its Web site:

"While we respect Prof. Behe's right to express his views, they are
his alone and are in no way endorsed by the department. It is our
collective position that intelligent design has no basis in science,
has not been tested experimentally and should not be regarded as
scientific."
==
Electric Fish on Verge of Evolutionary Split
Electric fish emit weak signals from an organ in their tails that serves as a
battery. Different emissions signal aggression, fear or courtship.
While the fish can apparently understand each others' warning signals, "They
seem to only choose to mate with other fish having the same signature waveform
as their own," explains neurobiologist Matt Arnegard of Cornell University.
But in the Ivindo River in Gabon, Arnegard and colleagues have found fish with
the same DNA emitting distinctly different signals. The fish are likely on the
verge of splitting into two species, the researchers announced today.
"We think we are seeing evolution in action," Arnegard said.
Electric animals
Because electricity is easily transmitted in water, many species of amphibians
and fish have adapted to detect weak electric signals. Some, like sharks, use
it to find prey. Others, like the electric eel, generate deadly voltages for
defense or to kill prey. Others emit and detect electrical signals primarily
as a means to communicate with their own kind.
Electric fish are called mormyrids. The roughly 20 distinct species that have
been identified in the river, by their varying DNA, each emit distinct
signals, which is the basis for Arnegard's new conclusion.
The process of splitting one species into two is called speciation. Scientists
figure there are two ways it can happen. Groups can become geographically
separated and take on new traits as their genes mutate. Or, animals can stay
together but for some reason mate selectively to form distinct groups.
The latter method, called sympatric speciation, is seen to be less likely and
somewhat controversial.
"Many scientists claim it's not feasible," Arnegard said. "But it could be a
detection problem because speciation occurs over so many generations."
Arnegard cautioned that it is possible the differing electrical signals might
be like varying eye color and possibly won't result in speciation. He plans to
return to the site this month to continue the research project, which is funded
by the National Geographic Society.
==
Darwin's Finches Evolve Before Scientists' Eyes
Share this sto
For the first time scientists have observed in real-time evolutionary changes
in one species driven by competition for resources from another.
In a mere two decades, one of Charles Darwin's finch species, Geospiza fortis,
reduced its beak size to better equip itself to consume small sized seeds,
scientists report in the July 14 issue of the journal Science.
The finch once had its own kingdom on the Galapagos Island of Daphne Major. It
had its pick of seeds to eat. But the arrival of another species of finch about
20 years ago, and additional food competition from a drought on the island in
2003, changed everything.
"When there is a severe drought on a small island, natural selection occurs,"
said study co-author Peter Grant of Princeton University.
The new larger species ate the larger and harder seeds on the island, food
that the biggest members of the native finch clan normally ate.
"The recent immigrant species had almost eaten the supply of food themselves,
so they almost went extinct," Grant said. "The resident species, the species
that was there before the new species arrived, underwent a large shift toward
small size in beaks."
Typically, the small members of the species can't crack the larger seeds. But
with the depletion of the larger seeds, the small-beaked population, which
could reach the smaller feed and needed less food to meet its daily energy
needs, had a better survival rate.
This type of evolutionary change is known as character displacement.
"It's a very important one in studies of evolution because it shows that
species interact for food and undergo evolutionary change, which minimizes
further evolution," Grant said. 'It has not been possible to observe the whole
process from start to finish in nature."
===
Housecats around the world can now trace their ancestry back to the Near
Eastern wildcat, Felis silvestris lybica, researchers say after a new
DNA analysis.
A wildcat, Felis silvestris lybica, which was trapped as part of the
research into the origin of cat domestication. (Image Science)
Domestic cats come from a founder population of five or more felines
that were domesticated in the Fertile Crescent zone of the Near East
probably sometime over 9,000 years ago, they said.
These cats would have come from a lineage that split off from F. s. lybica
around 107,000 to 155,000 years ago.
They likely began their association with humans by feeding on rodent
pests infesting grain stores of the first farmers, wrote the researchers,
reporting their findings in the June 29 issue of the research journal
Science.
The scientists, Carlos Driscoll of the University of Oxford, U.K. and
colleagues studied evolutionary relationships among domestic cats
and the wild cat subspecies: the European wildcat, the Near Eastern
wildcat, the Central Asian wildcat, the southern African wildcat, and
the Chinese desert cat.
Wild and domestic cats have often interbred so closely that its almost
impossible to tell the two apart, they noted.
The domestic cat is sometimes considered a subspecies of its own, F. s.
catus, though technically domestic cat can mean any domesticated
feline.
Using genetic material from 979 cats, Driscoll and colleagues
analyzed the variation among DNA sequences at a variety of marker
spots within the genomes, to determine which lineages were most closely
related.
They found that each of the subspecies as well as domestic cats fell into
a distinct, genetically related group, or clade.
One clade included domestic cats and some wildcats from the Middle East,
suggesting that this group stems from the ancestral founder population
of all domestic cats, they wrote.
==
Scientists describe giant penguins
WASHINGTON - Giant penguins roamed what is now Peru more than 40 million years
ago, much earlier than scientists thought the flightless birds had spread to
warmer climes.
Best known for their formal attire and presence in Antarctica, penguins today
live in many islands in the Southern Hemisphere, some even near the equator.
But scientists thought they hadn't reached warm areas until about 10 million
years ago
Now, researchers report in this week's online edition of Proceedings of the
National Academy of Sciences that they have found remains of two types of
penguin in Peru that date to 40 million years ago.
One of them was a 5-foot giant with a long sharp beak.
Paleontologist Julia Clarke, assistant professor of marine, earth and
atmospheric sciences at North Carolina State University, said she was
surprised at the new find.
"This is the same age as the earliest penguins from South America. The only
other record from the continent of that age is from the southernmost tip of
the continent," she said. "The new finds indicate they reached equatorial
regions much earlier than anyone previously thought."
The big bird is larger than any penguin known today and the third largest
known to have ever lived, she added.
It is particularly unusual for such a large penguin to have been living in a
warm climate, she noted. "In most cases, the larger individuals of a species
or among related species are correlated with colder climes and higher
latitudes."
The beak of the large penguin Icadyptes salasi "looks remarkably spearlike,"
she said. But the researchers don't know its exact feeding style.
The second new species Perudyptes devriesi was approximately the same size
as a living King Penguin 2 1/2 to 3 feet tall and represents a very early
part of penguin evolutionary history, the researchers said.
The research was funded by the National Science Foundation Office of
International Science and Engineering and the National Geographic Society.
==
My paper concerns the regulation of a human gene by DNA derived from an
endogenous retrovirus (ERV). An ERV is a viral sequence that has become part
of the infected animal's genome. Upon entering a cell, a retrovirus copies its
RNA genome into DNA, and inserts the DNA copy into one of the host cell's
chromosomes. Different retroviruses target different species and types of host
cells; the retrovirus only becomes endogenous if it inserts into a cell whose
chromosomes will be inherited by the next generation, i.e. an ovum or sperm
cell. The offspring of the infected individual will have a copy of the ERV in
the same place in the same chromosome in every single one of their cells.
This happens more often than you might think; 8% of the modern human genome is
derived from ERVs. Repeated sequences of this kind were formerly considered to
be non-functional, or "junk" DNA. However, we're gradually finding more and
more examples of viral sequences that appear to have some kind of function in
human cells. For example, many ERV sequences play a role in human gene
regulation. ERVs contain viral genes, and also sequences - known as promoters
- that dictate when those genes should be switched on. When an ERV inserts
into the host's chromosome, its promoter can start to interfere with the
regulation of any nearby human genes. In the example that I researched, the
ERV promoter has become responsible for most of the expression of a particular
human gene in the large intestine.
Creationists and intelligent design advocates like to think that because some
ERVs have useful functions in the human genome, they must have been
deliberately put there by a creator / designer with that particular purpose in
mind. Of course, no-one can explicitly prove that that is incorrect - it's not
a falsifiable hypothesis, and therefore it's not science. What we can show is
that ERVs provide evidence in support of the theory of evolution.
Let's imagine how ERVs would behave within a model of evolution by common
descent. An ancient creature, let's call it the common ancestor of all modern
mammals, is infected by a retrovirus that becomes endogenous. All of the
animal's descendants (i.e. all mammals) would be expected to carry the same
ERV insertion (ERV1) in the same chromosomal location.
Fast forward in evolutionary time. Different lineages have evolved and
diverged from the original common ancestor and there are now many different
types of mammal in existence, all carrying ERV1. A small rodent, let's call it
the common ancestor of mice and rats, is again infected by a species-specific
retrovirus that becomes endogenous. This is ERV2. In a parallel event in a
different lineage, the common ancestor of all great apes acquires a third
insertion, ERV3.
Moving forward again, a fourth ERV appears in some of these new-fangled human
thingies that are running around in Africa, but not in their hairier relatives
who will eventually evolve into modern chimpanzees. The early humans spread
out, and a fifth and (don't worry) final ERV arises in a population that is
isolated in a discrete geographical location. The infection does not spread to
other human populations.
So what would we expect? Humans, chimps, mice and rats should all possess
ERV1. The mouse and rat genomes will also contain ERV2, the virus that
infected their common ancestor, but not the primate-specific ERV3, 4 or 5
insertions. All great apes will share an identical ERV3 insertion; all humans
will also possess an ERV4 insertion that is not found in chimps or other apes.
In addition, some, but not all, humans will carry an insertion of ERV5. The
rodent-specific ERV2 insertion will not be found in any primate species.
Now that several genomes have been sequenced, we have begun to test these
predictions. The patterns of ERV insertions observed in modern species exactly
match the predictions made by the model described above. Some insertions are
shared between humans and mice and represent truly ancient viral infections.
Others are found only in primates, and not in other species, obviously derived
from an infection of the ancestral primate species after its divergence from
other lineages. More modern insertions are found only in humans, while the
youngest ERVs of all are found in some humans, but not in all. We do not find
any examples of ERV insertions shared by, say, humans and mice, but not by
chimps. Insertions are always shared by all species, and only by those
species, that have a common ancestor. ERV insertions therefore provide
excellent support for the theory of evolution by common descent.
My particular favourite ERV is found in various primate species, and therefore
must be at least 25 - 30 million years old. I compared the sequences and
activities of the same ERV promoter in the human, chimp, gorilla, and baboon
genomes. Despite some minor "single-letter" point mutations caused by DNA
copying errors, the promoter had essentially the same function in all four
species. I struggle to understand why any kind of designer would decide to use
different codes to perform the same function in different species, but there it
is. I hypothesised that the ERV was only allowed to persist (that is, its
meddling in gene regulation didn't kill the first organism in which it
inserted, which was therefore able to pass the insertion on to its offspring)
because the incoming ERV promoter behaved in a very similar way to the
original host cell's gene promoter. I wasn't able to do the experiments I
wanted in order to investigate this point, but another group subsequently did,
and their findings supported my hypothesis. That's what happens when you make
and test falsifiable predictions.
===
Many species of dandelion and subpopulations of other species of dandelion
(the genus forms a very complicated genetic complex) do not need
fertilization AT ALL. They do not even self pollinate. They
reproduce by a method called apomixis and are often genetically
triploid.
So these species go to the trouble and metabolic expense of producing
nice bright flowers, sugary nectar and an attractive scent, but the
bees and butterflies which visit do not contribute a damn thing to
seed production. The flowers, except for the tiny ovule which
eventually becomes the seed, is entirely vestigial, and costs the
plant dearly for no gain whatsoever. The petals, pistils, anthers,
nectar glands, etc., are simply evolutionary remnants of the times
when all dandelions relied on insects for pollination.
===
The Osteolepiformes (Devonian lungfish), from which mammals
evolved, did not have this problem. Only later did
the ancestors of mammals recruit the olfactory nares
of fish for the function of breathing on land. It so
happens that the nares (originally used only for smelling)
are on the opposite side of the esophagus from the lungs.
Humans have inherited this original design, even though
it now causes problems.
==
Philip Kitcher "Living With Darwin".
===
The first problem is that Behe's "scientific" ideas are offered to the public
in a trade book, and have never gone through the usual process of vetting in
peer-reviewed scientific journals. This was also the case with Darwin's Black
Box. In fact, Behe has never published a paper supporting intelligent design
in any scientific journal, despite his assertion in Darwin's Black Box that
his own discovery of biochemical design "must be ranked as one of the greatest
achievements in the history of science," rivaling "those of Newton and
Einstein, Lavoisier and Schrodinger, Pasteur, and Darwin." Surely such an
important theory deserves a place in the scientific literature! But the reason
for the lack of peer review is obvious: Behe's ideas would never pass muster
among scientists, despite the fact that anybody who really could disprove
Darwinism would win great renown.

How did the non-random mutations come about? Well, they were obviously created
by the Intelligent Designer. In Darwin's Black Box, Behe made the outrageous
claim that the Designer might have engineered the first cell to contain all
the mutations for the evolution of every species that would ever exist. This
claim is manifestly false: such a cell would have unmanageably large amounts
of DNA, and we see no evidence of "future DNA reserves" in primitive organisms
such as bacteria. Behe still raises this possibility in his new book, but he
also floats another idea: that mutations might not have been built into the
first organism but could have occurred later, foreseen by God. In other words,
they were miracles. So you can choose between the two possibilities: either
mutations occurred in one big miracle or in millions of little miracles. The
first claim is religious and false. The second claim is religious and
untestable. Neither claim is scientific.
Who, precisely, was the Designer? Here Behe weasels a bit, as he should given
the federal judiciary's dislike of religion in the science classroom. He
mentions that the Christian God is only one of several possibilities. But you
can bet that it was not Brahma, or the Bushmen's Kaang, or a space alien. As
Jones remarked in Kitzmiller v. Dover: "Consider, to illustrate, that
Professor Behe remarkably and unmistakably claims that the plausibility of the
argument for ID depends upon the extent to which one believes in the existence
of God." It is disingenuous of IDers to pretend that the Great Designer is
unknown. Intelligent design has deep roots in fundamentalist Christianity, and
its advocates are not fooling anyone.
And what were the Designer's goals? This is where Behe really gives away the
game. He asserts that the goal was "intelligent life." Of course, what he
really means is humans, presumably because Christians (Behe is a Catholic)
feel that humans were made in the image of God: "What we sense, as elaborated
through modern science's instruments and our reasoning, is that we live in a
universe fine-tuned for intelligent life." And elsewhere: "Parts were moving
into place over geological time for the subsequent, purposeful, planned
emergence of intelligent life."
From God's mouth to Behe's ear! At this point we can simply stop asking
whether Behe's theory is scientific, for he provides not the slightest
evidence that evolution had any goal, much less one of intelligent life. In
fact, every form of life on Earth, from humans to ferns to squirrels, can
trace its ancestry back to the same single species that lived about three and
a half billion years ago. In that sense, all species are equally evolved and
equally removed in time from life's origin. Science long ago dispensed with
the notion of the scala natura: a progressive ladder of life with humans at
the top. Rather, each existing species is at the tip of a branch on the tree
of life. So what scientific reason can there be for singling out just one
species as the Designer's goal? How do we know that the goal was not
butterflies or sunflowers? Plainly, Behe is adopting religious dogma as part
of his theory. Yet he continues to assert that "I regard design as a
completely scientific conclusion."
And what about the features of organisms that do not look well designed, such
as the appendix, the vestigial wings of the kiwi bird, or the vestigial pelvis
of whales? In Darwin's Black Box, Behe punted and said that the Designer's
goals were unknowable: "Features that strike us as odd in a design might have
been placed there by the designer for a reasonfor artistic reasons, for
variety, to show off, for some as-yet-undetected practical purpose, or for
some unguessable reasonor they might not." But if we do not know why the
Designer did things, how can we possibly know that his goal was intelligent
life?
Finally Behe gets to theodicy: why is there pain and evil in the world if the
Designer is omnipotent? How come He/She/It allows innocent babies to get
sickle-cell anemia? Behe's answer is that "maybe the Designer isn't all that
beneficent or omnipotent. Science can't answer questions like that." But
questions about the goals, the powers, and the limitations of the Designer are
precisely what must be answered if ID is to become scientific. After all, we do
know something about the power and the limitations of natural selection, a
process that can explain pain and things that seem evil.
Is Behe's theory testable? Well, not really, since it consists not of positive
assertions, but of criticisms of evolutionary theory and solemn declarations
that it is powerless to explain complexity. And it is certainly true that
scientists will never be able to give Darwinian explanations for the evolution
of everything. The origins of many features, such as the bony plates on the
back of the Stegosaurus, are lost in the irrecoverable past. But neither can
archaeology unearth everything about ancient history. We do not maintain on
these grounds that archaeology is not a science.
Behe waffles when confronted with the testability problem of ID and turns it
back on evolutionists, saying that "coming from Darwinists, both objections
[the lack of predictions and the untestability of ID] are instances of the pot
calling the kettle black." He then waffles even more when implying that ID does
not even need to be testable: "Both additional demandsfor hard-and-fast
predictions or for direct evidence of a theory's fundamental principleare
disingenuous. Philosophers have long known that no simple criterion, including
prediction, automatically qualifies or disqualifies something as science, and
fundamental entities invoked by a theory can remain mysterious for centuries,
or indefinitely. "
==
What we do not mean by "random" is that all genes are equally likely to mutate
(some are more mutable than others) or that all mutations are equally likely
(some types of DNA change are more common than others). It is more accurate,
then, to call mutations "indifferent" rather than "random": the chance of a
mutation happening is indifferent to whether it would be helpful or harmful.
Evolution by selection, then, is a combination of two steps: a "random" (or
indifferent) stepmutation that generates a panoply of genetic variants, both
good and bad (in our example, a variety of new coat colors); and then a
deterministic stepnatural selectionthat orders this variation, keeping the
good and winnowing the bad (the retention of light-color genes at the expense
of dark-color ones).
It is important to clarify these two steps because of the widespread
misconception, promoted by creationists, that in evolution "everything happens
by chance." Creationists equate the chance that evolution could produce a
complex organism to the infinitesimal chance that a hurricane could sweep
through a junkyard and randomly assemble the junk into a Boeing 747. But this
analogy is specious. Evolution is manifestly not a chance process because of
the order produced by natural selectionorder that can, over vast periods of
time, result in complex organisms looking as if they were designed to fit
their environment. Humans, the product of non-random natural selection, are
the biological equivalent of a 747, and in some ways they are even more
complex. The explanation of seeming design by solely materialistic processes
was Darwin's greatest achievement, and a major source of discomfort for those
holding the view that nature was designed by God.

Malaria actually provides a superb example of natural selection, and its story
has some intriguing quirks. The disease is caused by a protozoan carried by
mosquitoes, who act as flying syringes that inject the microbe into the human
bloodstream. There it takes up residence in the liver and then in the red
blood cells, multiplies prolifically, and can ultimately cause anemia, kidney
failure, hemorrhage, and death. Residence in red blood cells and the liver is
adaptive for the parasites, because in those spots they are hidden from the
immune system that usually destroys invading microbes. Yet the human spleen
can also detect and destroy circulating parasite-laden cells. To counter this
tactic, the malaria parasite secretes proteins that cause its carrier blood
cells to stick to the walls of blood vessels, avoiding the spleen (this
sticking is what causes hemorrhage).
Here, then, is an arms race between a blood-loving parasite and a human body
seeking to destroy it. Yet the story is even more complicated and interesting.
In sub-Saharan Africa, where malaria is rampant, a mutation has arisen in the
gene producing hemoglobin that helps ward off malaria. The striking thing
about this mutation, known as the sickle-cell mutation, is that it somehow
reduces the chances of contracting malaria when its carriers have one copy of
the gene (like most organisms, we have two copies of every gene, one on each
of our two sets of chromosomes) , but it causes sickle-cell anemia when the
carriers have two copies. In sickle-cell anemia, the red blood cells form
clumps because of the altered hemoglobin they carry, causing a syndrome of
complications that invariably cause death before adulthood.
Thus we have the unusual situation in which heterozygotes, or individuals
carrying both one "normal" and one "mutant" hemoglobin gene, are fitter than
homozygous individuals, who carry either two "normal" genes (more susceptible
to malaria) or two mutant genes (death from sickle-cell anemia). Evolutionary
genetics tells us that in a case such as this one, both forms of the gene will
remain in the population, ensuring some protection against malaria but also the
continuing production of babies with sickle-cell anemia. Africans would be
better off if everyone were a heterozygote, but that is impossible, because
the two gene copies separate at reproduction and unite with other copies,
necessarily producing some deleterious homozygotes.
This example shows that natural selection does not necessarily produce
absolute perfection; it works with whatever mutations arise to create the best
possible situation given the available raw material and the constraints of
genetics. And finally, although the malaria parasite has been unable to
counter-evolve resistance to heterozygotes for the sickle-cell gene, it has
evolved, through mutation, resistance to various anti-malarial drugs devised
by humans. This resistance has become so strong that some strains of malaria
are completely resistant to drugs yet another example of successful mutation
changes.
==
Chimps are in no important biological way different
from us. They too have opposable thumbs. However,
it's not just our prefrontal lobes that grow larger
than theirs, but our entire neocortex. Again, this is
simply a matter of degree. We have no special organ
or structure that they don't have. Our differences
are a matter of arrangement & size, not kind.
For instance, chimp throats are not as dissimilar
to ours as once thought, given their physcial
inability to speak as we do, despite having the
capability to understand language:
The same applies to behavior as to anatomy. There
is no difference in kind between us & chimps. It's
only a matter of degree.
As for the different evolutionary paths that we &
chimps have taken from our common ancestor of about
six million years ago, there is no reason why you
should expect both lines to develop bigger brains,
since our environments grew dissimilar. Hominids
adapted to the drier, grassier conditions east & south
of the Great Rift, which started rising some eight
million years ago. The ancestors of chimps, bonobos &
gorillas continued living to the west & north of that
barrier, which kept their central & western African
habitats wetter & more forested, more like that in
which our common ancestors lived.
Big brains take a lot energy, in the form of fat,
to operate. For most species already highly
intelligent, like apes, that added expenditure
wouldn't be adaptive, so there was no selective
pressure on ancestral chimps for brains to get bigger
in succeeding generations. Among hominids, however,
larger neocortexes did offer a selective advantage, as
previously had walking upright. Not only that, but
our ancestors' savannah habitat provided a source of
the fat our bigger brains needed, in the form of
marrow in the long bones of African big game animals
living in the same mixed woodland & plains
environment.
In a classic feedback system, our ancestors used
bigger brains to make new tools to exploit this
resource, which in turn enabled their brains to grow
larger over the generations. The key adaptation was
the use of rocks to break open marrow-rich bones that
even giant prehistoric hyenas couldn't crack. The
same rocks, plus tree limbs, dust & eventually fire
also served to drive off the other predators &
scavengers competing for the same resources.
Meanwhile, back in the jungle, evolution wasn't
increasing the brain size of our ape kinfolk because
there was no selective advantage for them in that
adaptive direction. The hominids, by contrast,
underwent an adaptive radiation along with many other
groups of African plains animals during the Pliocene.
Our species is the only one left, though, since we
went the farthest along the big brain route,
out-competing our hominid relatives.
==
Gorillas Gave Pubic Lice to Humans, DNA Study Reveals
http://news.nationalgeographic.com/news/2007/03/070316-gorilla-lice.html?sou
rce=rss
Scott Norris for National Geographic News
March 16, 2007
What exactly went on between gorillas and early humans? No one knows
for sure, but scientists say one thing, at least, seems certain: The
big apes gave us pubic lice.
Researchers made the uncomfortable discovery during a DNA study
reconstructing the evolutionary history of lice in humans and our
primate relatives.
The transfer occurred about 3.3 million years ago, said study leader
David Reed, of the University of Florida in Gainesville. That's when
the gorilla louse and the human pubic louse separated into distinct
species, the research revealed.
Modern humans (Homo sapiens) weren't around at the time. So the first
to be infested by the new lice species were probably Australopithecus,
a group of human ancestors that include the famous Lucy fossil.
Prior to the transfer our ancestors were troubled by only one species
of body louse, as chimpanzees and gorillas are today. Why humans can
harbor two specieshead lice and pubic licehas been a
mystery until
now.
The discovery raises the same vexing question faced by anyone who has
contracted pubic lice: How exactly did this happen?
Pubic lice are spread most commonly through sexual contact, but that's
not necessarily how our ancestors acquired the parasite from gorillas.
Unfortunately, we'll never know for sure, Reed said. Given that the
[gorilla louse] species occurs primarily in the pubic region, it is
quite possible that the lice were transmitted sexually.
A more likely scenario, though, is that early humans picked up the
parasites simply by living in close proximity to gorillas, perhaps
using the animals' sleeping sites or scavenging gorilla remains, he
said.
The study appears in a recent edition of the journal BMC Biology.
Good Night, Gorilla
Reed's team studied changes in primate and lice genes to determine
when different louse species originated.
Human head lice share a common ancestor with chimpanzee lice. The new
data showed that the two emerged as separate species at the same time
that humans and chimps parted evolutionary ways, about six million
years ago.
Such co-speciation is typical of lice and other parasites, which can
often evolve in tandem with their animal hosts.
Our pubic lice, by contrast, are most closely related to the gorilla
louse. But gorilla and human lineages diverged seven million years
ago, so co-speciation couldn't explain the origin of the pubic louse.
Instead, the parasite must have spread from one primate to the other
long after they had evolved into separate species.
Even discounting the possibility of sexual transmission, the discovery
gives anthropologists intriguing new information about the lifestyle
and behavior of early human ancestors.
These results may suggest that [our ancestors] lived or partially
dwelt in forests and perhaps even slept in nests of foliage built by
gorillas, said Mark Pagel, of the University of Reading in England.
Our Bodies, Our Habitats
Understanding where human lice came from still doesn't fully explain
our unusual capacity to harbor two distinct varieties of the
bloodsucking parasite.
For lice, each host species is, in effect, a unique island of
habitat, study leader Reed noted. The parasites become adapted to
local conditions such as hair size and blood type.
[Lice] are simply stranded on their hosts with no means of escape,
he explained. They can't fly, they can't jump, and they can't live
apart from the host for any period of time.
The loss of hair over most of our bodies may have created two distinct
habitat islands in humans. The scalp and pubic regions differ
significantlyand they are separated by largely inhospitable
terrain.
Pubic lice could not have established on humans without suitable
habitat, Reed said. Loss of body hair would have left the pubic
region an open island of habitat that [the gorilla louse] could have
colonized.
Dale Clayton, of the University of Utah in Salt Lake City, called it
a fascinating example of ecological opportunism.
Different hair diameters [in the scalp and pubic regions] probably
represent different habitat templates, he said, just as
different-size tree branches are used by different species of birds.
===
There is essentially no genetic difference between
humans & chimps. We have the same genes, but the
codons which control how long this or that gene
operates are turned on & off at different times, so
that, for instance, our leg bones grow longer. That's
the difference, same as between Przewalski's wild
horse & domesticated horses. Just as with humans &
the other great apes, the two horse species'
karyotypes differ in that two smaller wild horse
chromosomes fused into a single domestic horse
chromosome
==
http://www.evolution.mbdojo.com/evolution-for-beginners.html
==
Note also that an updated version of this article has been more
recently published in the June 2007 issue of Scientific American
magazine.
A Simpler Origin for Life by Robert Shapiro
(Scientific American, 2/12/2007)
Nobel Laureate Christian de Duve has called for "a rejection of
improbabilities so incommensurably high that they can only be called
miracles, phenomena that fall outside the scope of scientific
inquiry." DNA, RNA, proteins and other elaborate large molecules must
then be set aside as participants in the origin of life. Inanimate
nature provides us with a variety of mixtures of small molecules,
whose behavior is governed by scientific laws, rather than by human
intervention.
Fortunately, an alternative group of theories that can employ these
materials has existed for decades. The theories employ a
thermodynamic rather than a genetic definition of life, under a
scheme put forth by Carl Sagan in the Encyclopedia Britannica: A
localized region which increases in order (decreases in entropy)
through cycles driven by an energy flow would be considered alive.
This small-molecule approach is rooted in the ideas of the Soviet
biologist Alexander Oparin, and current notable spokesmen include de
Duve, Freeman Dyson of the Institute for Advanced Study, Stuart
Kauffman of the Santa Fe Institute, Doron Lancet of the Weizmann
Institute, Harold Morowitz of George Mason University and the
independent researcher Gunter Wachtershauser. I estimate that about a
third of the chemists involved in the study of the origin of life
subscribe to theories based on this idea. Origin-of-life proposals of
this type differ in specific details; here I will try to list five
common requirements (and add some ideas of my own).
(1) A boundary is needed to separate life from non-life. Life is
distinguished by its great degree of organization, yet the second law
of thermodynamics requires that the universe move in a direction in
which disorder, or entropy, increases. A loophole, however, allows
entropy to decrease in a limited area, provided that a greater
increase occurs outside the area. When living cells grow and
multiply, they convert chemical energy or radiation to heat at the
same time. The released heat increases the entropy of the
environment, compensating for the decrease in living systems. The
boundary maintains this division of the world into pockets of life
and the nonliving environment in which they must sustain themselves.
(2) An energy source is needed to drive the organization process. We
consume carbohydrates and fats, and combine them with oxygen that we
inhale, to keep ourselves alive. Microorganisms are more versatile,
and can use minerals in place of the food or the oxygen. In either
case, the transformations that are involved are called redox
reactions. They involve the transfer of electrons from an electron
rich (or reduced) substance to an electron poor (or oxidized) one.
Plants can capture solar energy directly, and adapt it for the
functions of life. Other forms of energy are used by cells in
specialized circumstances- -for example, differences in acidity on
opposite sides of a membrane. Yet others, such as radioactivity and
abrupt temperature differences, might be used by life elsewhere in
the universe. Here I will consider redox reactions as the energy
source.
(3) A coupling mechanism must link the release of energy to the
organization process that produces and sustains life. The release of
energy does not necessarily produce a useful result. Chemical energy
is released when gasoline is burned within the cylinders of my
automobile, but the vehicle will not move unless that energy is used
to turn the wheels. A mechanical connection, or coupling, is
required. Each day, in our own cells, each of us degrades pounds of a
nucleotide called ATP. The energy released by this favorable reaction
serves to drive processes that are less favorable but necessary for
our biochemistry. Linkage is achieved when the reactions share a
common intermediate, and the process is speeded up by the
intervention of an enzyme. One assumption of the small-molecule
approach is that coupled reactions and primitive catalysts sufficient
to get life started exist in nature.
(4) A chemical network must be formed, to permit adaptation and
evolution. We come now to the heart of the matter. Imagine for
example that an energetically favorable redox reaction of a naturally-
occurring mineral is linked to the conversion of an organic chemical
A to another one B within a compartment. The favorable, energy
releasing, entropy-increasing reaction of the mineral drives the A-to-
B transformation. I call this key transformation a driver reaction,
for it serves as the engine that mobilizes the organization process.
If B simply reconverts back to A or escapes from the compartment, we
would not be on a path that leads to increased organization. By
contrast, if a multi-step chemical pathway--say, B to C to D to A--
reconverts B to A, then the steps in that circular process (or cycle)
would be favored because they replenish the supply of A, allowing the
continuing discharge of energy by the mineral reaction.
(5) The network must grow and reproduce. To survive and grow, the
network must gain material at a rate that compensates for the paths
that remove it. Diffusion of network materials out of the compartment
into the external world is favored by entropy and will occur to some
extent, especially at the start of life when the boundary is a crude
one established by the environment rather than one of the highly
effective cell membranes available today after billions of years of
evolution. Some side reactions may produce gases, which escape, or
form tars, which will drop out of solution. If these processes
together should exceed the rate at which the network gains material,
then it would be extinguished. Exhaustion of the external fuel would
have the same effect. We can imagine, on the early Earth, a situation
where many startups of this type occur, involving many alternative
driver reactions and external energy sources. Finally, a particularly
hardy one would take root and sustain itself.
A system of reproduction must eventually develop. If our network is
housed in a lipid membrane, then physical forces may split it, after
it has grown enough. (Freeman Dyson has described such a system as
a "garbage-bag world" in contrast to the "neat and beautiful scene"
of the RNA world.) A system that functions in a compartment within a
mineral may overflow into adjacent compartments. Whatever the
mechanism may be, this dispersal into separated units protects the
system from total extinction by a localized destructive event. Once
independent units were established, they could evolve in different
ways and compete with one another for raw materials; we would have
made the transition from life that emerges from nonliving matter
through the action of an available energy source to life that adapts
to its environment by Darwinian evolution.
Systems of the type I have described usually have been classified
under the heading "metabolism first," which implies that they do not
contain a mechanism for heredity. In other words, they contain no
obvious molecule or structure that allows the information stored in
them (their heredity) to be duplicated and passed on to their
descendants. However a collection of small items holds the same
information as a list that describes the items. For example, my wife
gives me a shopping list for the supermarket; the collection of
grocery items that I return with contains the same information as the
list. Doron Lancet has given the name "compositional genome" to
heredity stored in small molecules, rather than a list such as DNA or
RNA.

The small molecule approach to the origin of life makes several
demands upon nature (a compartment, an external energy supply, a
driver reaction coupled to that supply, and the existence of a
chemical network that contains that reaction). These requirements are
general in nature, however, and are immensely more probable than the
elaborate multi-step pathways needed to form a molecule that can
function as a replicator.

Over the years, many theoretical papers have advanced particular
metabolism first schemes, but relatively little experimental work has
been presented in support of them. In those cases where experiments
have been published, they have usually served to demonstrate the
plausibility of individual steps in a proposed cycle. The greatest
amount of new data has perhaps come from Gunter Wachtershauser and
his colleagues at the Technische Universitat Munchen. They have
demonstrated portions of a cycle involving the combination and
separation of amino acids, in the presence of metal sulfide
catalysts. The energetic driving force for the transformations is
supplied by the oxidation of carbon monoxide to carbon dioxide. They
have not yet demonstrated the operation of a complete cycle or its
ability to sustain itself and undergo further evolution. A "smoking
gun" experiment displaying those three features is needed to
establish the validity of the small molecule approach.

The principal initial task is the identification of candidate driver
reactions--small molecule transformations (A to B in the example
before) that are coupled to an abundant external energy source (such
as the oxidation of carbon monoxide or a mineral). Once a plausible
driver reaction has been identified, there should be no need to
specify the rest of the system in advance. The selected components
(including the energy source) plus a mixture of other small molecules
normally produced by natural processes (and likely to have been
abundant on the early Earth) could be combined in a suitable reaction
vessel. If an evolving network were established, we would expect the
concentration of the participants in the network to increase and
alter with time. New catalysts that increased the rate of key
reactions might appear, while irrelevant materials would decrease in
quantity. The reactor would need an input device to allow
replenishment of the energy supply and raw materials, and an outlet
to permit the removal of waste products and chemicals that were not
part of the network.
In such experiments, failures would be easily identified. The energy
might be dissipated without producing any significant changes in the
concentrations of the other chemicals or the chemicals might simply
be converted to a tar, which would clog the apparatus. A success
might demonstrate the initial steps on the road to life. These steps
need not duplicate those that took place on the early Earth. It is
more important that the general principle be demonstrated and made
available for further investigation. Many potential paths to life may
exist, with the choice dictated by the local environment.
An understanding of the initial steps leading to life would not
reveal the specific events that led to the familiar DNA-RNA-protein-
based organisms of today. However, because we know that evolution
does not anticipate future events, we can presume that nucleotides
first appeared in metabolism to serve some other purpose, perhaps as
catalysts or as containers for the storage of chemical energy (the
nucleotide ATP still serves this function today). Some chance event
or circumstance may have led to the connection of nucleotides to form
RNA. The most obvious function of RNA today is to serve as a
structural element that assists in the formation of bonds between
amino acids in the synthesis of proteins. The first RNAs may have
served the same purpose, but without any preference for specific
amino acids. Many further steps in evolution would be needed
to "invent" the elaborate mechanisms for replication and specific
protein synthesis that we observe in life today.
If the general small-molecule paradigm were confirmed, then our
expectations of the place of life in the universe would change. A
highly implausible start for life, as in the RNA-first scenario,
implies a universe in which we are alone. In the words of the late
Jacques Monod, "The universe was not pregnant with life nor the
biosphere with man. Our number came up in the Monte Carlo game." The
small-molecule alternative, however, is in harmony with the views of
biologist Stuart Kauffman: "If this is all true, life is vastly more
probable than we have supposed. Not only are we at home in the
universe, but we are far more likely to share it with unknown
companions."
ROBERT SHAPIRO is professor emeritus of chemistry and senior research
scientist at New York University. He is author or co-author of over
125 publications, primarily in the area of DNA chemistry. In
particular, he and his co-workers have studied the ways in which
environmental chemicals can damage our hereditary material, causing
changes that can lead to mutations and cancer. In 2004, he was
awarded the Trotter Prize in Information, Complexity and Inference.
===
A pair of UCSF scientists has developed a model explaining
how simple chemical and physical processes may have laid
the foundation for life. Like all useful models, theirs
can be tested, and they describe how this can be done.
Their model is based on simple, well-known chemical and
physical laws.
The basic idea is that simple principles of chemical
interactions allow for a kind of natural selection on
a micro scale: enzymes can cooperate and compete with
each other in simple ways, leading to arrangements that
can become stable, or "locked in," says Ken Dill, PhD,
senior author of the paper and professor of pharmaceutical
chemistry at UCSF.
==
The issue is with the Hox systems that have been discovered in higher
organism. As Behe (page 181-182) notes: "Every Hox gene seen in the fruit fly
has a very similar counterpart in humans! ... The human counterpart to the
fruit fly gene that controls the growth of insect head parts directs
construction of regions near mammals' head (the genes of all mammals are
similar to those of humans). The tail end of humans is built under the
direction of the mammalian counterpart of the master fly regulatory gene
that directs the arrangement
of the insect's hindquarters. Even more strangle, as with the fly, the genes
in mammals were still lined up with body segments." So it seems that many of
our genes, including regulatory switches, have been co-opted from our distant
ancestors (as remote as insects). And now we find genes for body parts coming
in modules.
==
Evolution evidence
Fossil evidence sorted by time, corresponding to progression of early,
simple forms to diversity of modern forms, with numerous clear
transitional series.
Fossil evidence showing progression of whole ecosystems, with various
types of fossils associated with only certain other fossils.
Fossil evidence corresponding to plate tectonics, magnetic striping,
and other geological evidence.
Nested hierarchy of morphology.
Nested hierarchy of all the genomes studied so far.
The fact that these two nested hierarchies *match* is evidence in
itself.
Vestigial organs, structures, molecules, and behaviors.
Life is unified by a sharing of fundamental polymers, nucleic acids,
protein catalysts, etc.
You might want to check out:
http://www.talkorigins.org/faqs/comdesc/
http://www.talkorigins.org/faqs/faq-speciation.html
http://www.talkorigins.org/faqs/faq-transitional.html
===
Valentine Origin of Phyla
==
The cilia of malaria are actually stubs that have lost their ability to
function as cilia. Had they not, they would not have been classified as
Apicomplexans.

A single mutation for malaria to become resistant to chloro-quine occurred,
not the easiest mutation, to be sure, but still it took only a shift of
two amino acids.
==
First patent claimed on man-made life form.
A research institute has applied for a patent on what could be the first
largely artificial organism. And people should be alarmed, claims an
advocacy group that is trying to shoot down the bid.
The idea of owning a species breaches a societal boundary, said Pat
Mooney of the Ottawa, Canada based ETC Group, which is asking the patent
applicants to drop their claim. Creating and owning an organism, he
added, means that for the first time, God has competition.
The parasitic microbe M. genitalium
His group claims credit for spurring the European Patent Office last
month to revoke a patent on genetically modified soybeans by St.
Louis, Mo.based Monsanto Co., after a 13-year legal challenge by ETC.
The artificial organism, a mere microbe, is the brain-child of
researchers at the Rockville, Md.-based J. Craig Venter Institute. The
organization is named for its founder and CEO, the geneticist who led
the private sector race to map the human genome in the late 1990s.
The researchers filed their patent claim on the artificial organism
and on its genome. Genetcally modified life forms have been patented
before; but this is the first patent claim for a creature whose genome
might be created chemically from scratch, Mooney said.
Scientists at the institute designed the bacterium to have a minimal
genomethe smallest set of genes any organism can live on.
The project, which began in the early 2000s, was partly a philosophical
exercise: to help define life itself better by identifying its
barebones requirements. But it was also fraught with commercial
possibilities: if one could reliably recreate a standardized,
minimal life form, other useful genes could be added in as needed for
various purposes.
For instance, If we made an organism that produced fuel, that could be
the first billion or trillion dollar organism, said Venter in the June 4
issue of Newsweek magazine. The scientists based the design on the
bacterium Mycoplasma genitalium, in which they had identified an
estimated 265 to 350 core genes required for life.
Other researchers, pursuing similar research with other species,
have since claimed to be able to reduce this so-called minimal gene
somewhat further. The boundary of whats really the minimum gets fuzzy
because some of these pareddown creatures are so genetically challenged
that they hang on to life only with a lot of help.
In their U.S. patent application published May 31, Institute
scientists chose a somewhat more robust 381 to 386 genes as their
minimal genome for a hypothetical microbe, based on M. genitalium,
but dubbed Mycoplasma laboratorium.
In practice, the organism is being patented for what it is not, ETC said
in a statement this week.
In the patent application, the scientists also discussed the
possibility of creating the genes from scratch using chemical
methods, then injecting these into a cell whose own genome has been
removed. Whether that has actually been done yet is unclear, but many
people think Venters company has the scientific expertise to do the
job, said Mooney.
The same patent application has been published interntionally to be
submitted at over 100 national patent offices, said ETCs Jim Thomas in
an e-mail.
The Venter Institute did not respond to requests for comment. But Venter
and colleagues have argued that the stripped-down cell or other synthetic
microbes could be useful in tasks ranging from generating cheap energy
to aiding in agriculture and climate change remediation.
By creating a manmade organism as a platform for other genes to be
added at will, like software on a compuer, Venters enterprises are
positioning themselves to be the Microsoft of synthetic biolgy, ETC
said in a statement.
The organization claimed there could be drawbacks to allowing one
company to monopilize this information. For instance, the microbe
could be harnessed to build a virulent pathogen, Thomas said.
It could be a blow for open source biology the idea that researchers
should have free access to the fundamental tools and components of
synthetic biology, the new and growing science of redesigning and
rebuilding natural biological systems from the ground up for various
purposes.
Before these claims go forward, society must consider their
farreaching social, ethcal and envivironmental impacts, Thomas wrote
in the email. In its statement, the ETC Group said it will be writing to
Venter, to the U.S. Patent Office and the World Intellectual Property
Organization urging them to quash the patent effort until such a
public debate takes place.
An advocacy group is trying to shoot down a patent application on what could
be the first wholly manmade organism.The idea of owning a species breaches a
societal boundary, said said Pat Mooney of the Ottawa, Canadabased ETC Group,
which is challenging the patent claim. The notion of owning an organism, he
added, means that for the first time, God has competition.His group claims
credit for spurring the European Patent Office last month to revoke a patent
on genetically modified soybeans by St. Louis, Mo.based Monsanto Co., after a
13-year legal challenge by ETC.The artificial organism, a mere microbe, is the
brainchild of researchers at the Rockville, Md.-based J. Craig Venter
Institute. The organization is named for its founder and CEO, the geneticist
who led the private sector race to map the human genome in the late 1990s. The
researchers filed their patent claim on the artificial organism and on its
genome.Scientists at the institute designed the bacterium, dubbed Mycoplasma
laboratorium, to have a minimal genomethe smallest set of genes that any
organism can live on. The project, which began in the early 2000s, was partly
a philosophical exercise: to help define life itself better by identifying its
bare-bones requirements. But it was also fraught with commercial possibilities:
if one could reliably recreate a standardized, minimal life form, other useful
genes could be added in as needed for various purposes.For instance, If we
made an organism that produced fuel, that could be the first billion- or
trillion-dollar organism, said Venter in the June 4 issue of Newsweek
magazine.The scientists based the design on the bacterium Mycoplasma
genitalium, in which they had identified an estimated 265 to 350 core genes
required for life. Other researchers, pursuing similar research with other
species, have since claimed to be able to reduce this so-called minimal gene
somewhat further. The boundary of whats really the minimum gets fuzzy because
some of these pared-down creatures are so genetically challenged that they
hang on to life only with a lot of help. In their U.S. patent application
published May 31, Institute scientists chose a somewhat more robust 381 to 386
genes as their minimal genome for a hypothetical microbe, based on M.
genitalium, but dubbed Mycoplasma laboratorium.In practice, the organism is
being patented for what it is not, ETC said in a statement this week.In the
patent application, the scientists also discussed the possibility of creating
the genes from scratch using chemical methods, then injecting these into a
cell whose own genome has been removed. Whether that has actually been done
yet is unclear, but many people think Venters company has the scientific
expertise to do the job, said Mooney.The same patent application has been
published internationally to be submitted at over 100 national patent offices,
said ETCs Jim Thomas in an email. The Venter Institute did not immediately
respond to requests for comment.By creating a man-made organism as a platform
for other genes to be added at will, like software on a computer, Venters
enterprises are positioning themselves to be the Microsoft of synthetic
biology, ETC said in a statement.The organization claimed there could be
drawbacks to allowing one company to monopolize this information. For
instance, the microbe could be harnessed to build a virulent pathogen, Thomas
said. It could be a blow for open source biology the idea that researchers
should have free access to the fundamental tools and components of synthetic
biology, the new and growing science of redesigning and rebuilding natural
biological systems from the ground up for various purposes.Finally, it could
theoretically open the way for patenting plants, animals and people, according
to ETC group. Before these claims go forward, society must consider their
far-reaching social, ethical and environmental impacts, Thomas wrote in the
email.In the statement, the ETC Group said it will be writing to Venter, to
the U.S. Patent Office and the World Intellectual Property Organization urging
them to quash the patent effort until such a public debate takes place.
===
A Post-Synaptic Scaffold at the Origin of the Animal Kingdom
Sponges lack neurons with clearly recognizable synapses, but are the closest
living relatives of animals that have them (Eumetazoa). This analysis of the
genome of the demosponge Amphimedon queenslandica found that it possesses
nearly all the proteins required to build a post-synaptic complex. This
suggests that a protein scaffold capable of forming one half of a synapse may
have predated the evolution of nervous systems.
===
Discovery of new species of fish gives evolution clues
A Chinese research team has discovered four
fossils of a new species of fish dating back 400 million years which may
provide clues to the evolution of fish.
Dr. Zhu Min, the leading scientist from the Chinese Academy of Sciences
(CAS) Institute of Vertebrate Paleontology and Pale anthropology, said Sunday
that the newly discovered species may represent a bridge between two
vertebrate lineages that ultimately went on to dominate the modern world.
The find made by Zhu and his colleagues was published in the latest issue
of the British journal Nature.
The fossilized creature, found in southwest China's Yunnan Province,
combines features shown by ray-finned bony fishes, including the majority of
modern fish species, and by lobe-finned bony fishes, the group that spawned
the ancestors of today's land vertebrates, Dr. Zhu said.
The ancient fish, represented by chunks from four separate skulls, has a
skull roof much like that of actinopterygian, the group that includes most
modern fish, Dr. Zhu said.
But the fine features of its anatomy may also shed light on the
evolutionary origin of cosmine - a hard surface-tissue found in many fossil
sarcopterygians, the fish that later gave rise to land vertebrates, he said.
Cosmine is characterized by a network of pores and canals in the tissue,
overlaid by a single enamel-based layer, Zhu explained.
The 405 million-year-old fossil possessed several such layers over the
pore-canal network, suggesting that the cosmine arose after all but one of
these layers disappeared, he said.
Zhu named the ancient fish after his mentor, Prof. Meemann Chang, China's
most prominent paleontologist and also a CAS member. Prof. Chang laid the
foundation of modern research on ancient bony fishes.
With the latest find, Dr. Zhu and his team are trying to prove that
lobe-finned bony fishes originated from south China.
By the age stated, we are looking at Silurian/Devonian.
==
The limits of selection during maize domestication

Rong-Lin Wang1, Adrian Stec1, Jody Hey2, Lewis Lukens1 and John Doebley1

1.	Department of Plant Biology, University of Minnesota, St Paul, Minnesota
55108 , USA
2.	Department of Genetics, Rutgers University , Piscataway, New Jersey
08854-8082, USA

The domestication of all major crop plants occurred during a brief period in
human history about 10,000 years ago1. During this time, ancient
agriculturalists selected seed of preferred forms and culled out seed of
undesirable types to produce each subsequent generation. Consequently,
favoured alleles at genes controlling traits of interest increased in
frequency, ultimately reaching fixation. When selection is strong,
domestication has the potential to drastically reduce genetic diversity in a
crop. To understand the impact of selection during maize domestication, we
examined nucleotide polymorphism in teosinte branched1, a gene involved in
maize evolution2. Here we show that the effects of selection were limited to
the gene's regulatory region and cannot be detected in the protein-coding
region. Although selection was apparently strong, high rates of recombination
and a prolonged domestication period probably limited its effects. Our results
help to explain why maize is such a variable crop. They also suggest that maize
domestication required hundreds of years, and confirm previous evidence that
maize was domesticated from Balsas teosinte of southwestern Mexico.

Several lines of evidence indicate that maize is a domesticated form of the
wild Mexican grass teosinte (Zea mays ssp. parviglumis or spp. mexicana)3, 4,
5. Archaeological evidence places the time of maize domestication between
5,000 and 10,000BP6. Despite the recent derivation of maize from teosinte,
these plants differ profoundly in morphology5. One major difference is that
teosinte typically has long branches with tassels at their tips whereas maize
possesses short branches tipped by ears. Genetic analyses have identified
teosinte branched1 (tb1) as the gene that largely controls this difference2.
Recent cloning of tb1 ( ref. 7) provides the first opportunity to examine the
effects of selection on a 'domestication gene' and to infer from these effects
the nature of the domestication process.

During development, tb1 acts as a repressor of organ growth in those organs in
which its messenger RNA accumulates. Consistent with this interpretation,
plants carrying the maize allele accumulate more tb1 mRNA in lateral-branch
primordia and have shorter branches (that is, greater repression of branch
elongation) than plants carrying the teosinte allele, which accumulate less
tb1 mRNA and have longer branches7. This difference in message accumulation
between the maize and teosinte alleles suggests that the evolutionary switch
from teosinte to maize involved changes in the regulatory regions of tb1.

Domestication should strongly reduce sequence diversity at genes controlling
traits of human interest. To test this expectation for tb1, we sampled a
2.9-kilobase (kb) region (Fig. 1) including most of the predicted
transcriptional unit (TU) and 1.1kb of the 5' non-transcribed region (NTR)
from a diverse sample of maize and teosinte (Table 1). Two measures of genetic
diversity were calculated: , the expected heterozygosity per nucleotide site,
and, an estimate of 4 N e, where N e is the effective population size and the
mutation rate per nucleotide8. Within the TU, maize possesses 39% of the
diversity found in teosinte, which is not significantly lower than that (71%)
seen for the neutral gene, Adh1 ( Table 2). However, within the NTR, maize
possesses only 3% of the diversity found in teosinte. Thus, selection during
domestication is associated with strongly reduced diversity in the NTR where
regulatory sequences are typically found, but more modestly reduced diversity
in the TU.
For the sliding-window analysis, was calculated for segments of 300bp at
50-bp intervals. Sequences used in the analysis were the subset of the -cloned
sequences for which we isolated the 3' end by PCR ( Table 1). The position of
the Hin dIII (H) restriction endonuclease sites used in cloning are shown, as
are the predicted exons (rectangles) and coding region (stippled).

If tb1 contributed to the morphological evolution of maize, then in the tb1
phylogeny for maize and teosinte, maize sequences should form a single clade
with only minor differentiation among them. Moreover, the type of teosinte
most closely related to the direct ancestor of maize should be associated with
the maize clade. In contrast, previous research with neutral genes not involved
in maize evolution has shown that maize sequences for such genes are dispersed
among multiple clades owing to the effects of lineage sorting9, 10, 11, 12,
13. A phylogeny for the tb1 TU fits the expectation of a neutral gene, with
maize sequences falling into multiple clades (Fig.2a). However, the phylogeny
for the NTR shows all maize on a single, well-supported clade (I) ( Fig. 2b),
as predicted for a gene involved in maize evolution. There are five teosinte
sequences tightly associated with the maize sequences and all belong to ssp.
parviglumis. The teosinte (sample 16L) basal to clade I also belongs to ssp.
parviglumis. This phylogeny and previous research14 provide compelling
evidence that ssp. parviglumis (Balsas teosinte) is the progenitor of maize
and suggest that maize arose in the Balsas river valley of southwestern
Mexico, where this subspecies is native.

(b). Taxa include maize, ssp. parviglumis (PAR), ssp. mexicana (MEX) and
the outgroup Z. diploperennis (DIP). Sample numbers follow the taxon names.
Scale bars indicate the number of substitutions per site using Kimura's
2-parameter distances. Clade I was supported in 200 of 200 bootstrap
resamplings of the original data. An initial analysis of the 5'
non-transcribed region using the 22 maize and teosinte -cloned sequences
indicated that all maize alleles were derived from ssp. parviglumis . To
confirm whether this result would be sustained with a larger sample, we
isolated 16 additional sequences for a more comprehensive analysis (see
Although the phylogenies and the relative amount of nucleotide variation in
maize suggest that selection has acted on tb1, we collected data on nucleotide
polymorphism specifically to determine whether tb1 has experienced a recent
selective sweep. This determination was made using the HKA test15, in which
the ratio of polymorphism within a species (maize) to divergence from an
outgroup (Z. diploperennis) for tb1 was compared with this ratio for neutral
genes. A recent selective sweep in maize would be expected to reduce this
ratio for tb1 relative to neutral genes. The HKA test was not significant for
the TU, indicating that there is no evidence for selection on the coding
region ( Table 3). However, the test was highly significant for the NTR,
indicating that selection has strongly reduced variation here. Remarkably, the
HKA test for the NTR was significant even if the TU was used as the control.
This shows that the 'hitchhiking' effect was so small that it did not even
affect the entire gene.
The relative impact of selection on the NTR and TU can be readily seen in a
plot of polymorphism () for maize and teosinte along the length of tb1 (Fig.
1). Throughout the NTR, is substantially lower in maize than in teosinte,
reflecting the impact of selection. At the boundary between the NTR and the
TU, for teosinte drops precipitously, as expected, because there is greater
constraint on coding regions; however, for maize rises until it is nearly
equal to for teosinte. Finally, approaching the stop codon at the 3' end of
the gene, rises steeply in both maize and teosinte, reflecting reduced
constraint in this non-translated region. Figure 1 shows graphically how the
impact of selection on polymorphism was narrowly focused on the NTR.

As further evidence that regulatory changes in the NTR rather than changes in
protein function were involved in maize evolution, we examined the predicted
amino-acid sequence of our maize and teosinte sequences. Because our maize and
teosinte clones did not include the 3' end of the TU unit, we isolated and
sequenced an additional segment spanning the end of the clones to 170 base
pairs (bp) downstream of the stop codon ( Table 1). Over the entire coding
region, there are no fixed differences in the predicted amino-acid sequences
between maize and teosinte.

Our analysis of nucleotide polymorphism in tb1 provides compelling evidence
that selection during maize domestication was aimed at the NTR, where
regulatory elements are typically found. We had previously observed that the
tb1 mRNA for the maize allele accumulates at twice the level of that for the
teosinte allele and proposed that changes in tb1 regulation underlie maize
evolution7. Combined evidence from polymorphism analysis and previous work on
tb1 mRNA levels are thus congruent, providing strong evidence that the short,
ear-tipped lateral branches of maize evolved from the long, tassel-tipped
branches of teosinte by human selection for novel regulatory elements in the
NTR.

Although our data implicate selection on regulatory sequences during maize
evolution, we found no fixed differences between maize and teosinte within the
1.1kb of NTR that we analysed. In fact, some maize and teosinte sequences (for
example, maize 1P and parviglumis 18L) are nearly identical within this region,
differing by only 1bp in the length of a poly(A) track. This may indicate
either that the selected site lies further upstream or that the differences
between maize and teosinte are complex and depend on a group of polymorphisms
rather than a single site16. Recombination between an upstream selected site
and the region we sequenced could explain why maize is not fully separated
from teosinte in the phylogeny ( Fig.2b).

Selection intensities during domestication are expected to be high because
crop evolution involves dramatic changes in morphology within a short time.
Under directional selection, the selection coefficient (s) is measured as the
difference in relative fitness of the most fit and least fit genotypes, where
fitness is the contribution of a genotype to the next generation. For example,
s = 0.01 would indicate that 100 maize alleles would be passed to the next
generation for every 99 teosinte alleles. A rough estimate of s requires a
knowledge of the recombination rate (c , crossovers per bp per generation) and
the distance (d) in bp from the selected site over which there has been a
substantial reduction in nucleotide variation17:

For maize, recombination rates have been empirically measured for several
genes, giving a mean value for c of 4 10-7 (refs 1820). Two observations
allow a preliminary estimate of d : first, the substantial reduction in
nucleotide variation is restricted to the NTR or promoter and does not extend
into the TU, and, second, plant promoters are normally 2kb or less in size.
Thus, the selected site is likely to be less than 2kb from the
TU and must be at least 1.1kb from the TU since it does not appear to lie in
the 1.1kb of NTR that we sequenced. Using these values, s is estimated to be
between 0.04 and 0.08. This estimate can be refined in the future by obtaining
direct estimates of c in tb1 and identifying the precise position of the
selected site.

When s is known, one can estimate the time (T f) required to bring the maize
allele to fixation22. We assume that the initial frequency of the maize allele
was 1/2N, where N is the population size, and that gene action was additive2.
We considered two population sizes during the time of selection: 1,000, which
assumes teosinte was grown like a horticultural crop in gardens, and 100,000,
which assumes it was grown like an agriculture crop but still over a limited
geographical area. We assume values for s of 0.04 and 0.08 (see above). For
these values, T f ranges from 315 to 1,023 years. Thus, the morphological
evolution of maize as controlled by tb1 could have been rapid, over just
several hundred years.

We were surprised that maize remained polymorphic for tb1, even within the
NTR. To assess whether the observed level of variation at tb1 in maize is
consistent with previous estimates of mutation and recombination rates,
population sizes and the time of maize domestication, we carried out
coalescent simulations23. The simulations included a selective sweep modelled
on a range of estimates for T s (time since the selective sweep) and s (Table
4). To measure the effect of a selective sweep so that it reflects the present
context of not knowing the actual site of selection, we measured the longest
segment with zero, one or two polymorphic sites. The simulated mean values of
these lengths are remarkably close to the observed data. Thus, even for genes
under strong selection, domestication need not remove all variation. The
ability of maize to remain polymorphic at tb1 probably reflects high
recombination rates over the hundreds of years required to bring the maize
allele to fixation such that there was substantial recombination between the
allele that initially harboured the selected site and other alleles in the
population. By this means, considerable polymorphism was maintained in the
coding region in the face of strong selection on the NTR.

Population-genetic analysis of domestication genes can provide a new view of
the processes that sculpted the formation of crop species. For tb1, such
analysis indicates that ancient agriculturalists exerted a strong selective
force on tb1 that has drastically reduced polymorphism in its regulatory
region but not in its coding region. This observation is consistent with
previous evidence that alterations in the regulation of tb1 brought about the
change from teosinte to maize plant architecture. We also infer that it took
at least several hundred years to bring the maize allele of tb1 to fixation.
Finally, these analyses indicate that Balsas teosinte is the ancestor of
maize, since all maize alleles sampled show a close and statistically robust
phylogenetic association with this teosinte.

Gene isolation. All sequences for population-genetic analysis were cloned
into-ZAP (Stratagene) as Hin dIII fragments ( Fig. 1). Isolation of the 3' end
ofthe gene for the sliding-window analysis (Fig. 1) and determination of
thecomplete amino-acid sequence were accomplished by the PCR reaction(primers:
TAGTTCATCGTCACACAGCC and CAATAACGCACACCAGGTCC). PCR was performed using PCR
Supermix (Life Technologies) with one step of 4min at 95C followed by 30
cycles of 1min at 95C, 1min at 60C and 3min at 72C followed by 10min
at 72C. PCR products were cloned using the TOPO TA cloning kit (Invitrogen).
Additional sequences of the NTRfor phylogenetic analysis (Fig. 2) were
isolated by PCR (primers: GCTATTGGCTACAAGTGACC and GGATAATGTGCACCAGGTGT). All
sequences were deposited in GenBank (accession nos AF131649 to AF131705).

Statistics. Calculation of the range of reasonable values for s requires an
estimate of the position of the selected site relative to the TU. The selected
site is expected to lie within the NTR region in which regulatory sequences
occur. Such regions typically extend 2kb or less upstream of the TU in
plants. For example, average gene density in Arabidopsis is one gene for every
4.8kb24. With an average gene being about 2.5kb long, this leaves about 2kb
for flanking regulatory sequences. Moreover, many reports in the literature
reveal that 5' regulatory sequences are usually within 1kb of the
transcription start site. For the coalescent simulations, the middle of the
4,000-bp sampled chromosomes was set as the point of a selective sweep. For
the moderate values of s modelled, the use of deterministic allele frequency
change will closely follow a stochastic selective sweep17. The population
mutation rate () was set to 0.0262 per bp, which is the estimated value from
teosinte in the tb1 NTR. The effective population size was set to the value
(700,000) estimated for maize at Adh1, based on estimates of and for Adh1
(ref. 9). The recombination rate (c) was set to 4 10-7 as described in the
text. Sample size was 12, the same as the number of maize clones, and 200
runs were performed.

References
1.	Harlan, J. Crops and Man (Am. Soc. Agron., Madison, WI, (1992).
2.	Doebley, J. , Stec, A. & Gustus, C. Teosinte branched1 and the origin of
maize: evidence for epistasis and the evolution of dominance. Genetics 141,
333346 (1995).|PubMed|ISI|ChemPort|
3.	Beadle, G. Teosinte and the origin of maize. J. Hered. 30, 245247 (1939).
4.	Galinat, W. The origin of maize as shown by key morphological traits of its
ancestor, teosinte. Maydica 28, 121 138 (1983).|ISI|
5.	Iltis, H. From teosinte to maize: the catastrophic sexual transmutation.
Science 222, 886894 ( 1983).|ISI|
6.	Smith, B. The Emergence of Agriculture (Freeman, New York, (1995 ).
7.	Doebley, J. , Stec, A. & Hubbard, L. The evolution of apical dominance in
maize. Nature 386, 485488 ( 1997).|Article|PubMed|ISI|ChemPort|
8.	Watterson, G. On the number of segregating sites in genetical models
without recombination. Theor. Popul. Biol. 7, 188 193 (1975).
9.	Eyre-Walker, A. , Gaut, R. , Hilton, H. , Feldman, D. & Gaut, B.
Investigation of the bottleneck leading to the domestication of maize. Proc.
Natl Acad. Sci. USA 95, 44414446 (1998).|Article|PubMed|ChemPort|
10.	Buckler, E. & Holtsford, T. Zea systematics: ribosomal ITS evidence. Mol.
Biol. Evol. 13, 612 622 (1996).|PubMed|ISI|ChemPort|
11.	Goloubinoff, P. , Paabo, S. & Wilson, A. Evolution of maize inferred from
sequence diversity of an Adh2 gene segment from archaeological specimens.
Proc. Natl Acad. Sci. USA 90, 19972001 (1993).
12.	Hanson, M. et al. Evolution of anthocyanin biosynthesis in maize kernels:
the role of regulatory and enzymatic loci. Genetics 143 , 13951407 (1996).
|PubMed|ISI|ChemPort|
13.	Hilton, H. & Gaut, B. Speciation and domestication in maize and its wild
relatives. Evidence from the globulin-1 gene. Genetics 150, 863872 (
1998).|PubMed|ISI|ChemPort|
14.	Doebley, J. , Goodman, M. & Stuber, C. Isoenzymatic variation in Zea
(Gramineae). Syst. Bot. 9, 203218 ( 1984).|ISI|
15.	Hudson, R. , Kreitman, M. & Aguade, M. Atest of neutral molecular
evolution based on nucleotide data. Genetics 116, 153 159
(1987).|PubMed|ISI|ChemPort|
16.	Stam, L. F. & Laurie, C. C. Molecular dissection of a major gene effect on
a quantitative trait: the level of alcohol dehydrogenase expression in
Drosophila melanogaster. Genetics 144, 15591564
(1996).|PubMed|ISI|ChemPort|
17.	Kaplan, N. , Hudson, R. & Langley, C. The "hitchhiking effect" revisited.
Genetics 123, 887899 (1989).|PubMed|ISI|ChemPort|
18.	Okagaki, R. & Weil, C. Analysis of recombination sites within the maize
waxy locus. Genetics 147, 815821 (1997).|PubMed|ISI|ChemPort|
19.	Patterson, G. , Kubo, K. , Shroyer, T. & Chandler, V. Sequences required
for paramutation of the maize b gene map to a region containing the promoter
and upstream sequences. Genetics 140, 13891406
(1995).|PubMed|ISI|ChemPort|
20.	Dooner, H. & Martinez-Ferez, I. Recombination occurs uniformly within the
bronze gene, a meiotic recombination hotspot in the maize genome. Plant Cell
9, 1633 1646 (1997).|Article|PubMed|ISI|ChemPort|
21.	Xu, X. , Hsia, A. , Zhang, L. , Nikolau, B. & Schnable, P. Meiotic
recombination break points resolve at high rates at the 5' end of a maize
coding sequence. Plant Cell 7, 21512161
(1995).|Article|PubMed|ISI|ChemPort|
22.	Kimura, M. & Ohta, T. The average number of generation until fixation of a
mutant gene in a finite population. Genetics 61, 763771 (1969). |ISI|
23.	Hudson, R. Properties of a neutral allele model with intragenic
recombination. Theor. Popul. Biol. 23,
183201(1983).|PubMed|ISI|ChemPort|
24.	Bevan, M. et al. Analysis of 1.9Mb of contiguous sequence from chromosome
4 of Arabidopsis thaliana. Nature 391, 485488 (1998). |Article|
25.	Doebley, J. & Stec, A. The structure of teosinte branched1 : a progress
report. Maize Genet. Coop. News1. 73(1998).
==
1) Archaeological evidence shows corn has been domesticated
for about 6,000 years.

2) Genetic evidence suggests domestication of corn began
about 9,000 years ago.

3) Archaeological evidence shows barley was domesticated
about 9,000 years ago.

4) Cserhati makes calculations based on "uniformitarian
assumptions" .

5) Cserhati applies spreading rate of barley transposons
to entirely different genera (Sorghum, and the Zea).

*Numerous* genera and species. 600 genera, over
9,000 species, that *do not exchange genetic
information* . The family has been around for
over 50 million years, from the fossil record.

Evolution of Corn:

http://www.seedsofc hange.com/ enewsletter/ issue_43/ corn.asp
http://employees. csbsju.edu/ ssaupe/biol106/ lectures/ cereals.htm

Evolution of Sorghum:

http://www.bioline. org.br/request? cs95020

Evolution maize from teosinte was domesticated within only hundreds of years:
RongVLin, W. et al., The limits of selection during maize
domestication, Nature 398(18):236V238, 1999.

We know that there are two specific models in the spreading of
transposons within genomes. One is the linear model where a
transpsoosn element is copied and then inserts into another site
within the genome.

Archaeological evidence shows corn has been
domesticated for about 6,000 years.

Genetic evidence suggests domestication of corn
began about 9,000 years ago.

Archaeological evidence shows barley was
domesticated about 9,000 years ago.
===
How about 'ring' species?
"example of ring species is the Larus gulls circumpolar species "ring". The
range of these gulls forms a ring around the North Pole. The Herring Gull,
which lives primarily in Great Britain, can hybridize with the American
Herring Gull (living in North America), which can also interbreed with the
Vega or East Siberian Herring Gull, the western subspecies of which,
Birula's Gull, can hybridize with Heuglin's gull, which in turn can
interbreed with the Siberian Lesser Black-backed Gull (all four of these
live across the north of Siberia). The last is the eastern representative of
the Lesser Black-backed Gulls back in north-western Europe, including Great
Britain. However, the Lesser Black-backed Gulls and Herring Gull are
sufficiently different that they do not normally interbreed; thus the group
of gulls forms a continuum except in Europe where the two lineages meet. A
recent genetic study has shown that this example is far more complicated
than presented here (Liebers et al, 2004)."
http://en.wikipedia .org/wiki/ Ring_species
===
Every plant and animal in existence is a transitional form.If you could only
see the time period from 500,000 years in the past to 500,000 years in the
future, it would be self evident.
==
Genetic evidence from a comparison of human and Neanderthal mitochondrial
DNA (mtDNA) shows that while chimpanzee and human lineages diverged over
five million years ago, the Neanderthals diverged over 550,000 to 690,000
years ago. Other data places this estimate at between 365,000 and 853,000
years ago (Ovchinnikov, et al, 2000) and 465,000 before present with
confidence limits of 317,000 and 741,000 (Krings, 1999)
===
The fossil record is one major category of evidence for
evolution. The molecular record in the genomes of all
organisms is another. The past & present
biogeographical distribution of species, vestigial &
atavistic structures, & ontogeny & embryological
development are further groups of evidence, among
others. There is no evidence against the theory of
common descent by means of natural selection & other
evolutionary processes.

Mitochondrial DNA (mtDNA) sequences from four Neandertal fossils from Germany,
Russia, and Croatia has demonstrated that these individuals carried closely
related mtDNAs that are not found among current humans. However, these results
do not definitively resolve the question of a possible Neandertal contribution
to the gene pool of modern humans since such a contribution might have been
erased by genetic drift.
==
http://www.aliraqi.org/forums/showthread.php?t=34362 baby with tail
==
Read Douglas Hofstadter's most recent book, "I Am
a Strange Loop", to see how evolution would result in feelings.
==
The human embryo and the kidneys, first it grows one
pair of complete kidneys which dont get a chance to perform their
primary function of producing urine before they are discarded, the
second pair of complete kidneys start to produce urine before they are
discarded, but part of that second pair become the gonads of the
future human being, and it is only the third set that remain and carry
out the functions for which those kidneys are used for.
and regarding the dolphin embryo, four limb buds suggests it should be
a land dwelling creature as does the positioning of its nostrils, but
the dolphin is born with only the front limbs fully formed (yet highly
modified) and its nostrils on the top of its head.
==
Evolutionary History of the Origin of Feathers,
Walter J. Bock,
American Zoologist 2000 40(4):478-485
http://icb.oxfordjournals.org/cgi/reprint/40/4/478
==
http://www.genome.org/cgi/content/full/12/11/1663 human genome
http://en.wikipedia.org/wiki/Chimpanzee_Genome_Project chimp

===
The wild ancestor of the domesticated apple, Malus
domestica, is Malus sierversii, a species that grows
in the mountains of Kazakhstan. Many travelers along
the ancient Silk Road passed through the forests of
Kazakhstan, which were filled in certain places with
apple trees that reached heights of up to sixty feet.
They probably picked and carried the fruit with them
on their journeys.
The ancient Greeks and Romans were the first people to
domesticate the apple. Pliny the Elder, (a Roman
nobleman and historian who died in the eruption of Mt.
Vesuvius in 79 A.D.) wrote that the Romans cultivated
twenty-three different varieties of apple. They
brought some of these varieties with them when they
invaded England, including the tiny Lady apple, which
is still available in supermarkets at Christmastime.
Apples strongly exhibit the biological characteristic
of heterozygosity. Each wild apple (Malus sierversii)
contains approximately 5 seeds, each of which contains
the genetic instructions for a distinctly different
apple tree. Each tree will bear fruits that look and
taste very different from those on the other trees,
ranging in size from ping-pong balls to softballs and
ranging in color from yellow to purple. The same is
true of the domestic apple, Malus domestica. Apples
planted from seeds will express a wide variety of
traits and bear little resemblance to the parent apple.
==
Recent work shows that apes are not a monophyletic group (all descended from
one ancestor), so that chimps and gorillas share a more recent ancestor with
humans than they do with the orangutan. That means that, on the strict
taxonomic level, chimps and gorillas are hominids.
==
Dobzhansky decades ago made new species of fruit flies
through artificial selection. Recently, researchers
made a new butterfly species via hybridization between
two related parental species. Then virtually the same
species was found in the wild in Colombia, showing
that the laboratory process had in effect recreated
the course of evolution in nature.

http://www.planetar k.org/avantgo/ dailynewsstory. cfm?newsid= 36812

It's easy to make new plant species through various
means, such as polyploidy, just as happens in nature.
Recently a genetically engineered grass escaped from a
lab in Oregon & was able to survive on its own in the
wild.
The list of species "created" in labs is long. Some
researchers are now in the process of creating
microbes from scratch, using only the prebiotic
molecules available to the first life forms to arise
from chemical evolution, starting biological evolution.
===
bacteria genes
http://pathmicro.med.sc.edu/mayer/genetic%20ex.htm
http://www.mines.edu/academic/envsci/courses/esgn586/Vetsigian.2006.pdf
==
Oldest Lobster Fossil Found in Mexico.
http://news.nationalgeographic.com/news/2007/05/070503-oldest-lobster.html?
source=rss
This fossil crustacean found in Mexico's Chiapas state in 1995 has now
been confirmed as the world's oldest lobster, according to scientists
at the National Autonomous University of Mexico (UNAM).
The ancient animal has been dated at 110 million years oldabout 20
million years older than previously known specimensUNAM scientists
announced in a press release on Monday.
"This lobster that we found in Chiapas belongs to the genus that is in
Africa today," UNAM geologist Francisco Javier Vega Vera told the
Reuters news service.
"This isn't a surprise, because at that time  Africa and America were
relatively close." The two continents are believed to have started
splitting apart about 120 million years ago.
The juvenile fossil lobster, dubbed Palinurus palaceosi, was among the
remains of several ancient fish and crustaceans found in a quarry in
the tiny town of El Espinal. Vera says the region could be where the
evolution of modern lobsters began.
"The important message that we can give is that the evolution of these
groups of crustaceans needs to be reviewed, since the specialists of
the world thought that it started much later," Vera said in the UNAM
press release.
"We could call them living fossils, since they have had a consistent
morphologic pattern throughout many millions of years."
=====
> Provide one single scientific study that you believe makes a best
> case of proving evolution. We'll examine it and put it to the
> scientific test..
This in principle is a great idea and maybe we can work toward
something like this. The problem is, and it may be difficult for
people outside the field to fully appreciate it, is that biology -
which fully includes and integrates evolution on every level- is a
fairly mature science at this stage in the game. Just as astronomy
is a fairly mature science. (Yes, of course we have a lot to learn
in both... let's not get derailed with that rebuttal)
Asking for the best single study that makes the case for evolution is
like asking an astronomer what the best study is that makes the case
for the Earth and other planets orbitting the sun. Modern,
professional astronomers no longer argue over this fact. There are
no current astronomical research groups dedicated to trying to nail
down the evidence for a sun-centric solar system. If you look at a
professional astronomy journal today you will find it filled with
reems of minutiae, many of which may depend in some way on a sun-
centered solar system, but scarce few that trumpet the latest piece
of evidence confirming this notion. Why bother? It would be met
with yawns and take up valuable space.
Like it or not, biology is in the same stage with evolution. It's
not that we are not allowed to question it or anything, its just that
to professional biologists its so damned obvious that every bit of
evidence supports evolution that we're simply past that simple
phase. Thousands of papers are published every month that rely on or
elucidate details of evolution, but it is the rare paper that can be
taken out of context and presented as some sort of independent proof
of the fact of evolution. It's the accumulation and integration of
all these studies and papers from so many different angles that
convinces.
Creationists, because they are continually embroiled in their self-
made 'controversy' about evolution, tend to think there's still some
question about the truth of evolution amongst those trained in
biology. Nope. Sorry. We're past that. Just as astronomers are
well past wondering if Earth is really the center of the solar
system. There's no conspiracy and nothing closed-minded about it.
It's simply an understanding of the evidence and an acceptance of
reality.
==
Donkeys have 62 chromosomes & horses 64, yet they're
both now placed in the same genus, Equus. A mule or
hinny resulting from this inter-specific cross has 63
chromosomes & is usually sterile, although offspring
have been produced from crosses with horses & donkeys.
Zebras (also in genus Equus) present a difficulty for
Preston's idea of kinds, since the southernmost race
of zebra produced infertile offspring when crossed
with the northernmost, but subspecies (true biological
races) from the central part of the zebra range are
fully interfertile (or were, since some races are
extinct).
Horses & donkeys are about as closely related
genetically as humans & chimps, which also have two
more chromosomes than people because two of theirs are
fused into one of ours. Yet we're currently placed in
separate genera, unlike the equines. Taxonomists lump
equines & split apes, for whatever reason.

http://www.livescie nce.com/animalwo rld/060713_ darwin_finch. html

The same could apply to the flightless Hawaiian Nene
goose & its presumptive Canada goose immigrant
ancestors or to the dodo & its transoceanic pioneer
pigeon forebearers.
==
Mudskippers probably won't evolve into land animals
because every available niche on land is already
occupied by a far better adapted land animal.
Mudskippers have their own niche, & have hit on a way
to help them survive as fish, not full-time
terrestrial creatures.
Woolly mammoths evolved relatively rapidly because the
climate changed abruptly, putting great selective
pressure on steppe mammoths of northern Eurasia. The
Pleistocene glaciations, a series of 100,000 year long
ice ages, produced many new animal & plant species.
The arctic bowhead whale (probably the mammalian
species with the longest individual life span) evolved
from northern right whales to deal with ocean ice,
just as the polar bear evolved rapidly from the brown
bear (grizzly in North America) by specializing in
hunting ringed seals, which depend on shore-fast ice
to breed.
Modern birds are descended from Cretaceous shorebirds
which were able to avoid some of the catastrophic
consequences of the impact thought to have caused this
extinction event, such as global forest fires.
Burrowing mammals also survived.
The tetrapod foot & hand evolved in increasing well
documented stages from the lower four fins of certain
Devonian lobe-finned lungfish, which already had arm &
leg bones.
Birds & tyrannosaurs don't just share some general
traits. They share specific derived traits, which can
be traced back over about 150 million years of
dinosaur evolution & indeed long before that, to the
common archosaur roots of dinosaurs & pterosaurs,
which split off from their crocodilian cousins after
the biggest of all extinction events at the end of the
Permian Period of the Paleozoic Era & beginning of the
Triassic Period of the Mesozoic Era.
==
Tetrapods ("four
legged" land vertebrates) evolved in the Devonian Period, 417 to 354 million
years ago (mya), from lobe-finned lungfish.
1) There are two groups of bony fish, ray-finned &
lobe-finned. Now only two kinds of lobe-fins remain,
the deep sea coelacanth of the Indian Ocean & three
genera of lungfish in South America, Africa &
Australia. But in the Devonian lobe-fins were common
in both salt & fresh water. Coelacanths swim very
differently from the ray-finned fish prevalent today.
They "stilt walk" on four lower fins along the sea floor.
Lobe-finned fish surviving today include both the
oceanic ceolacanth & largely freshwater lungfish.
Both groups have "living fossils" apparently unchanged
for millions of years, although their genomes are
probably different from those of their ancestors.
Great adaptive radiations like the mammals after the
extinction event at the end of the Mesozoic Era
(dinosaurs) often occur when many niches are opened up
the elimination of the organisms previously occupying
those niches.
==
Eldredge and Tattersall
The main impetus for expanding the view that species are discrete at any one
point in time, to embrace their entire history, comes from the fossil record.
Paleontologists just were not seeing the expected changes in their fossils as
they pursued them up through the rock record. Instead, collections of nearly
identical specimens, separated in some cases by 5 million years, suggested
that the overwhelming majority of animal and plant species were tremendously
conservative throughout their histories.
That individual kinds of fossils remain recognizably the same throughout the
length of their occurrence in the fossil record had been known to
paleontologists long before Darwin published his Origin. Darwin himself,
troubled by the stubbornness of the fossil record in refusing to yield
abundant examples of gradual change, devoted two chapters to the fossil
record. To preserve his argument he wasforced to assert that the fossil record
was too incomplete, to full of gaps, to produce the expected patterns of
change. He prophesied that future generations of paleontologists would fill in
these gaps by diligent search and then his major thesis - that evolutionary
change is gradual and progressive - would be vindicated. One hundred and
twenty years of paleontological research later, it has become abundantly clear
that the fossil record will not confirm this part of Darwin's predictions. Nor
is the problem a miserably poor record. The fossil record simply shows that
this prediction is wrong.
The observation that species are amazingly conservative and static entities
throughout long periods of time has all the qualities of the emperor's new
clothes: everyone knew it but preferred to ignore it. Paleontologists, faced
with a recalcitrant record obstinately refusing to yield Darwin's predicted
pattern, simply looked the other way. Rather than challenge well-entrenched
evolutionary theory, paleontologists tacitly agreed with their zoological
colleagues that the fossil record was too poor to do much beyond supporting,
in a general sort of way, the basic thesis that life had evolved.
==
We must first start with the abstract. Gould presents the basics of his
argument within the article's abstract, which is very important to read in
this context. Here is quoted the entire abstract on page 2:
"Nature's discontinuities occur both in the hierarchical structuring of
genological individuals and in the distinct processes operating at different
scales of time, here called tiers. Conventional evolutionary theory denies
this structuring and attempts to render the larger scales at simple
extrapolation from (or reduction to) the familiar and immediate -- the
struggle among organisms at ecological moments (conventional individuals at
the first tier). I propose that we consider distinct processes at three
separable tiers of time: ecological moments, normal genological time (trends
during millions of years) and periodic mass extinctions.
"I designate as "the paradox of the first tier" our failure to find progress
in life's history, when conventional theory (first tier processes acting on
organisms) expects it as a consequence of competition under Darwin's metaphor
of the wedge. I suggest a resolution of the paradox: whatever accumulates at
the first tier is sufficiently reversed, undone, or overridden by processes of
the higher tiers. In particular, punctuated equilibrium at the second tier
produces trends for suites of reasons unrelated to the adaptive benefits of
organisms (conventional progress). Mass extinction at the third tier, a
recurring process now recognized as a more frequent, more rapid, more intense
and more different than we had imagined, works by different rules and may undo
whatever the lower tiers had accumulated." (Gould, Stephen J., "The Paradox of
the First Tier: An Agenda for Paleobiology," Paleobiology 11(1) 1985, pp 2-12)
Now, to set the context of the "quote nugget" cited at the top of this
section, it is in the light of the discussion on the "third tier". Note how
Gould is criticizing other aspects of his field in its conclusions and
methods, a habit that is typical of most critically-thinking scientists and is
a necessary and prevalent method of discourse in science. Context given below.
"IV. Establishment of the Independence of the Third Tier.
As ideas whose time may have come, mass extinction shares an interesting
property with punctuated equilibrium. Neither represents a new discovery; both
involve the reluctant acceptance of an acknowledged literal pattern that deep
biases of Western thought had led us to mitigate or deny. Just as we have long
known about stasis and abrupt appearance, but have chose to fob it off upon an
imperfect fossil record, so too have we long recognized the rapid, if not
sudden, turnover of faunas in episodes of mass extinction. We have based our
geological alphabet, the time scale, upon these faunal replacements. Yet we
have chosen to blunt or mitigate the rapidity and extent of extinctions with
two habits of argument rooted in uniformitarian commitments. First, we have
deemphasized some extinctions by drawing dubious phyletic connections across
the boundaries. Second, and more important, we have tried to distribute these
events more evenly in time by seeking evidence for slow declines before
boundaries and reduced peaks of extinction at the terminations themselves. In
short, we have tried to place mass extinctions into continuity with the rest
of life's history by viewing them as only quantitatively different -- more and
quicker of the same -- rather than qualitatively distinct in both rate and
effect."
In other words, Gould is arguing for the need to treat mass extinctions as
separate phenomena in themselves.
I would also like to add that in the previous section within this same paper,
on the subject of the "Second Tier", Gould was making the case for the
mechanism of punctuated equilibrium, where he showed that gradualism does not
explain the stasis and abrupt appearance in the fossil record, which is in
context with the work itself. Again, this section's particular misquote takes
advantage of the discussion of the merits of [punctuated equilibrium] over
gradualism. The misquoted phrase is reminding the reader that before the
hypothesis of punctuated equilibrium was proposed in the early 70's, evolution
was thought to operate as gradualism and the discontinuous fossil record was,
as Gould said, excused as merely incomplete.
What makes this particular misquote even more egregious is that they didn't
just take Gould out of context, but they engineered what he said in the first
place. This misquote supports the creationist claims of scientific
uber-conspiracies in favor of evolution, as if scientists deliberately ignore
the fossil evidence and pass it off without debating it, which is hardly the
case. Science demands that evidence be examined, critiqued, and debated, and
this is what Gould is doing in this very paper, with the presentation of his
case on the subject of hierarchical arrangements of mass extinctions in
relation to other evolutionary changes!
==
"This inconsistency has created a major problem for evolutionary biologists.
Darwin and most subsequent authors including G.G. Simpson have held that most
evolutionary transitions occur within established lineages by phyletic
gradualism guided by natural selection. But fossil species remain unchanged
throughout most of their history and the record fails to contain a single
example of a significant transition. Similarly, it is difficult to account for
the greatly accelerated pace of evolution during periods of adaptive radiation.
An alternative model of evolution, introduced by Niles Eldredge and Stephan Jay
Gould in the early 1970's, more fully accounts for these same observations.
According to this major conceptual breakthrough, rapid evolution is typically
associated with speciation events that occur cryptically in small isolated
populations, often at the edge of a species's geographic range." (Woodroff,
D.S., Science (208) 1980 716-717).
==
(Eldredge, Niles, The Pattern of Evolution, 199
"There are clear connections between these varying ecological patterns of
resiliency, from the smallest scale of the individual organism, through
ecological succession, to the even larger scale of habitat tracking.
Individual organisms and, in the later two cases, entire species tend to
survive by moving around, sending out propagules to rebuild ecosystems,
whether locally degraded (Cercopia on El Yunque) or regionally revamped (as
when glaciers slowly move south from the arctic). But evolution is classically
about change. So far, local and regional patterns of ecological resiliency
imply stability of individual species lineages, not evolutionary change. Where
and how does real evolution come into the picture?
"Consider the effect of Hurricane Hugo on El Yunque, and on the entire island
of Puerto Rico, for that matter. Prior to Hugo's hit in 1989, the endemic
Puerto Rican parrot had been reduced to fewer than 100 known individuals
living in the Loquillo Mountains, of which El Yunque is one. Agriculture and
urbanization had already transformed so much of this bird species' habitat
that it was on the verge of extinction. Hugo took about 50 percent of the
remaining birds. Though the population has since recovered to approximately
pre-Hugo proportions, and is now being augmented by a captive breeding
program, Hugo might very well have done away with these beautiful animals
entirely.
"In other words, physically induced ecological calamity, if great enough in a
real scope and intensity, can drive all the populations of a species extinct.
Indeed, it can drive many different species extinct all at the same time. And
that's exactly what we paleontologists see in the fossil record as the
dominant pattern, not only of extinction, but of evolution as well.
"It is not just single species that are in stasis. Virtually all the component
species of regional ecosystems are evolutionarily stable, often for millions of
years. Of course, that's only half the pattern. Periodically, the majority of
those species disappear, to be replaced, in due course, by others. One way of
looking at this pattern is to see it as the ecological generalization of
stasis and change that underlies the notion of punctuated equilibria. It is a
simple ineluctable truth that virtually all members of a biota remain
basically stable, with minor fluctuations, throughout their durations.
(Remember, by "biota" we mean the commonly preserved plants and animals of a
particular geological interval, which occupy regions often as large as Roger
Tory Patterson's "eastern" region of North American birds.) And when these
systems change -- when the older species disappear, and new ones take their
place -- the change happens relatively abruptly and in lockstep fashion. It
affects most of the species in a region more or less at the same time.
Evolution goes hand in hand with the degradation and rebuilding of ecosystems,
and the origin of new species depends in large measure on the extinction of
older species. [Eldredge, Niles 1999 The Pattern of Evolution W. H. Freeman
and company, New York. Page 157-158.] [Emphasis in original.]

==
"Now let me step back from the problem and very generally discuss natural
selection and what we know about it. I think it is safe to say that we know
for sure that natural selection, as a process, does work. There is a mountain
of experimental and observational evidence, much of it predating genetics,
which shows that natural selection as a biological process works."

- David M. Raup, "Conflicts Between Darwin and Palaeontology," Field Museum of
Natural History Bulletin, pp. 22, 25, Chicago, January 1979.
==
(Bowler, Evolution: The History of an Idea, 1984, p. 187)
"Darwin devoted a chapter of the Origin to explaining the "imperfection of the
fossil record," arguing that the fossils we discover represent only a tiny
fraction of the species that actually have lived. Many species, and many whole
episodes in evolution, will have left no fossils at all, because they occurred
in areas where conditions were not suitable for fossilization. Apparently
sudden leaps in the development of life are thus illusions created by gaps in
the evidence available to us. Future discoveries may help to fill in some of
the gaps, but we can never hope to build up a complete outline of the history
of life."
==
(Simpson, George Gaylord, The Major Features of Evolution, 1953, p. 360)
"The chances that the remains of an organism will be buried, fossilized,
preserved in the rock to our day, then exposed on the surface of dry land and
found by a paleontologist before they disintegrate are extremely small,
practically infinitesimal. The discovery of a fossil of a particular species,
out of the thousands of millions that have inhabited the earth, seems almost
like a miracle even to a paleontologist who has spent a good part of his life
performing the miracle. Certainly paleontologists have found samples of an
extremely small fraction, only, of the earth's extinct species, and even for
groups that are most readily preserved and found as fossils they can never
expect to find more than a fraction.
"In view of these facts, the record already acquired is amazingly good. It
provides us with many detailed examples of a great variety of evolutionary
phenomena on lower and intermediate levels and with rather abundant data that
can be used either by controlled extrapolation or on a statistical sampling
basis for inferences as to phenomena on all levels up to the highest. Among
the examples are many in which, beyond the slightest doubt, a species or genus
has been gradually transformed into another. Such gradual transformation is
also fairly well exemplified for subfamilies and occasionally for families, as
the groups are commonly ranked. Splitting and subsequent gradual divergence of
species is also exemplified, although not as richly as phyletic transformation
of species (no doubt because splitting of species usually involves spatial
separation and paleontological samples are rarely adequate in spatial
distribution). Splitting and gradual divergence of genera is exemplified very
well and in a large variety of organisms. Complete examples for subfamilies
and families are also known, but are less common.
"In spite of these examples, it remains true, as every paleontologist knows,
that most new species, genera, and families and that nearly all new categories
above the level of families appear in the record suddenly and are not led up to
by known, gradual, completely continuous transitional sequences. When
paleontological collecting was still in its infancy and no clear examples of
transitional origin had been found, most paleontologists were
anti-evolutionists. Darwin (1859) recognized the fact that paleontology then
seemed to provide evidence against rather than for evolution in general or the
gradual origin of taxonomic characters in particular. Now we do have many
examples of transitional sequences. Almost all paleontologists recognize that
the discovery of a complete transition is in any case unlikely. Most of them
find it logical, if not scientifically required, to assume that the sudden
appearance of a new systematic group is not evidence for special creation or
for saltation, but simply means that a full transitional sequence more or less
like those that are known did occur and simply has not been found in this
instance."
==
(Futuyma,
"The transitional forms that evolve so quickly, and in such a small area, are
very unlikely to be picked up in the fossil record. Only when the newly evolved
species extends its range will it suddenly appear in the fossil record
Eldredge and Gould have suggested, therefore, that the fossil record should
show stasis, or equilibrium, of established species, punctuated occasionally by
the appearance of new forms. Hence, the fossil record would be most inadequate
exactly where we need it most -- at the origin of major new groups of
organisms."
==
"Our fossil record is almost exclusively the story of hard parts. But most
animals have none, and those that do reveal very little about their anatomies
in their outer coverings (what could you infer about a clam from its shell
alone?). Hence, the rare soft-bodied faunas of the fossil record are precious
windows into the true range and diversity of ancient life."
==
But nature is wasteful. Most species never give rise to anything, and
present-day phyla derive from a lucky minority. The not-so-lucky fossil species
may also be comfortably classified in these living phyla, but it is a feature
of many Cambrian assemblages that they contain a large proportion of forms that
cannot be so treated.
===
(Stanley, S.M., The New Evolutionary Timetable: Fossils, Genes, and the Origin
of Species, 1981
Superb fossil data have recently been gathered from deposits of early Cenozoic
Age in the Bighorn Basin of Wyoming. These deposits represent the first part of
the Eocene Epoch, a critical interval when many types of modern mammals came
into being. The Bighorn Basin, in the shadow of the Rocky Mountains, received
large volumes of sediment from the Rockies when they were being uplifted,
early in the Age of Mammals. In its remarkable degree of completeness, the
fossil record here for the Early Eocene is unmatched by contemporary deposits
exposed elsewhere in the world. The deposits of the Bighorn Basin provide a
nearly continuous local depositional record for this interval, which lasted
some five million years. It used to be assumed that certain populations of the
basin could be linked together in such a way as to illustrate continuous
evolution. Careful collecting has now shown otherwise. Species that were once
thought to have turned into others have been found to overlap in time with
these alleged descendants. In fact, the fossil record does not convincingly
document a single transition from one species to another. Furthermore, species
lasted for astoundingly long periods of time. David M. Schankler hasrecently
gathered data for about eighty mammal species that are known from more than
two stratigraphic levels in the Bighorn Basin. Very few of these species
existed for less than half a million years, and their average duration was
greater than a million years.
==
There is no doubt that intermediate taxa - mosaics of primitive and derived
characters - exist for many major groups.
==
Eldredge's Life Pulse
There is an alternative, however. Perhaps the fossil record is not so
hopeless, and the observation of no change within species and sudden
replacement between them reflects evolution as it actually occurs. Recall
Chapter 26: Large, successful, central populations are resistant to
evolutionary change. Small, isolated, marginal populations may speciate. The
process of speciation, though slow to a human observer (hundreds or thousands
of years), is geologically fleeting. In most geological situations, and at
most rates of sedimentation, a thousand years translates into a single bedding
plane, not a thick sequence of rock. Thus, if speciation is the dominate mode
of evolution, we should expect to see exactly what we do see: the unchanging
species represents a successful central population; its sudden replacement by
a descendent records the migration into the ancestral area of a descendant
that arose rapidly in a small population at the edge of the ancestor's
geographical range. Thus, it is possible that most evolution occurs in the
mode of speciation and that phyletic evolution is relatively unimportant.
==
Sunderland The Monkey Business and The Triumph of Evolution.
==
"Contrary to Creationist claims, the transitions among vertebrate species are
almost all documented to a greater or lesser extent. Archeopteryx is an
exquisite link between reptiles and birds; the therapsids provide an abundance
of evidence for the transition from reptiles to mammals. Moreover, there are
exquisite fossil links between the crossopterygian fishes and the amphibians
(the icthyostegids). Of course, many other ancestor-descendent series also
exist in the fossil record. I have mentioned (Chapter 4) the bactritid-ammonoid
transition, the derivation of several mammalian orders from condylarthlike
mammals, the evolution of horses, and of course the hominids."
"But in view of the rapid pace evolution can take, and the extreme
incompleteness of fossil deposits, we are fortunate to have as many transitions
as we do. The creationist argument that if evolution were true we should have
an abundance of intermediate fossils is built by denying the richness of
paleontological collections, by denying the transitional series that exist, and
by distorting, or misunderstanding, the genetical theory of evolution."
(Futuyma, D., Science on Trial: The Case for Evolution, 1983
=======
The case for geological change was made by Hutton in 1785, a lifetime before
Darwin's Origin of Species:
http://en.wikipedia .org/wiki/ Geologic_ timescale
Eighteenth & early 19th Century British geologists named the Cambrian,
Ordovician and Silurian Periods for Wales & ancient Welsh tribes, the
Devonian for the southwestern English county of Devon and the
Carboniferous is adapted from "the Coal Measures", the original
British geologists' term for strata above the Devonian, which used to
be called the "Age of Fishes". All this before Darwin.
Late in the Devonian, vertebrates first invaded the land, as shown in
greater detail by the recently discovered magnificent fossil
Tiktaalik, a species neatly intermediate between lobe-finned lungfish
& tetrapods (amphibians, reptiles & birds & mammals).
http://en.wikipedia .org/wiki/ Tiktaalik
==
These things also provide evidence for macroevolution:

Nested hierarchies
Convergence of independent phylogenies
Statistics of incongruent phylogenies
Many Transitional forms
Anatomical vestiges
Atavisms
Present biogeography
Past biogeography
Anatomical parahomology
Molecular parahomology
Anatomical convergence
Molecular convergence
Anatomical suboptimal function
Molecular suboptimal function
Protein functional redundancy
DNA functional redundancy
Transposons
Redundant pseudogenes
Endogenous retroviruses
==
A random event, in itself, will presumably not increase information.
But random mutations, _filtered through the non-random processes of natural
selection_, will.
==
The oldest dated zircons date from about 4400 My - very close to the
hypothesized time of the Earth's formation. The Greenland sediments
include banded iron beds. They contain possibly organic carbon and quite
possibly indicate that photosynthetic life had already emerged at that time.
==
Allele
(Science: genetics) Any one of a series of two or more
different genes that occupy the same position (locus) on a chromosome.
==
Scientific American on March 28, 2007:
http://www.sciam.com/article.cfm?articleID=9952573C-E7F2-99DF-32F2928046329479
&sc=I100322
"Primordial Soup's On: Scientists Repeat Evolution's Most Famous Experiment
Their results could change the way we imagine life arose on early Earth
By Douglas Fox
...
(Jeffrey) Bada discovered that the reactions were producing chemicals called
nitrites, which destroy amino acids as quickly as they form. They were also
turning the water acidic--which prevents amino acids from forming. Yet
primitive Earth would have contained iron and carbonate minerals that
neutralized nitrites and acids. So Bada added chemicals to the experiment to
duplicate these functions. When he reran it, he still got the same watery
liquid as Miller did in 1983, but this time it was chock-full of amino acids.
Bada presented his results this week at the American Chemical Society annual
meeting in Chicago.
===
The human brain has tripled in volume over just the last 2.5 million years.
==
"Given a divergence date of 6 MYa, the maximum inferred rate of nucleotide
substitution in the most divergent regions of DNA in humans and chimps is
~ 1.3 x 10-9 base substitutions per site per year."
====
An article in Science (2005) by Elisabeth Culotta is quoted : "The
total genetic difference between humans and chimps, in terms of number of
bases, sums to about 4% of the genome. That includes 35 million single base
substitutions plus 5 million insertions or deletions"
There are, in other words, about 40 million differences between the genomes
of humans and chimps. Assuming that we diverged about 6 million years ago,
that means that there must have been about 6 mutations per year, mostly in
the human genome, because humans are assumed to have developed more rapidly
than chimps.
==
Miller/Urey experiment
Bada discovered that the reactions were producing chemicals called nitrites,
which destroy amino acids as quickly as they form. They were also turning the
water acidicwhich prevents amino acids from forming. Yet primitive Earth would
have contained iron and carbonate minerals that neutralized nitrites and acids.
So Bada added chemicals to the experiment to duplicate these functions. When he
reran it, he still got the same watery liquid as Miller did in 1983, but this
time it was chock-full of amino acids. Bada presented his results this week at
the American Chemical Society annual meeting in Chicago.
But James Ferris, a prebiotic chemist at Rensselaer Polytechnic Institute in
Troy, N.Y., doubts that atmospheric electricity could have been the only source
of organic molecules. "You get a fair amount of amino acids," he says. "What
you don't get are things like building blocks of nucleic acids." Meteors,
comets or primordial ponds of hydrogen cyanide would still need to provide
those molecules.
===
There are 5743 species of amphibians known.

4,500 species of mammals are known.
Andrewsarchus was an aggressive wolf-like cow.
Research has shown that for the first 10 or 15
million years after the dinosaurs were wiped out, present day mammals kept a
very low profile, while these other types of mammals were running the show.
==
Called The Natural History Of Evolution by Philip Whitfield, 1993
ISBN 0 385 40388 7.(great Forward by Rodger Lewin.

Glorified Dinosaurs: The Origin and Early Evolution of Birds
by Luis M. Chiappe

Evolutionary Pathways in Nature: A Phylogenetic Approach (Paperback)
by John C. Avise

The Beginning of the Age of Mammals (Hardcover)
by Kenneth D. Rose (Author)

Why Size Matters: From Bacteria to Blue Whales (Hardcover)
by John Tyler Bonner (Author)

Why Size Matters: From Bacteria to Blue Whales (Hardcover)
by John Tyler Bonner (Author)
==
Our genetic blueprint consists of 3.42 billion nucleotides packaged in 23
pairs of linear chromosomes. Most mammalian genomes are of comparable sizethe
mouse script is 3.45 billion nucleotides, the rat's is 2.90 billion, the cow's
is 3.65 billionand code for a similar number of genes: about 35,000. Of course,
extremes exist: the bent-winged bat (Miniopterus schreibersi) has a relatively
small 1.69-billion-nucleotide genome; the red viscacha rat (Tympanoctomys
barrerae) has a genome that is 8.21 billion nucleotides long. Among
vertebrates, the highest variability in genome size exists in fish: the green
puffer fish (Chelonodon fluviatilis) genome contains only 0.34 billion
nucleotides, while the marbled lungfish (Protopterus aethiopicus) genome is
gigantic, with almost 130 billion. Interestingly, all animals have a large
excess of DNA that does not code for the proteins used to build bodies and
catalyze chemical reactions within cells. In humans, for example, only about 2
percent of DNA actually codes for proteins.
==
Man's earliest direct ancestors looked more apelike than previously believed
A computer-generated reconstruction by NYU College of Dentistry Professor Dr.
Timothy Bromage, shows a 1.9 million-year- old skull belonging to Homo
rudolfensis with a surprisingly small brain and distinctly protruding jaw. Dr.
Bromage's is the first scientist to produce a reconstruction of the skull that
questions Richard Leakey's depiction of modern man's earliest direct ancestor
as having a vertical facial profile and a relatively large brain -- an
interpretation widely accepted until now.
==
There are about 300 species of cycads, plants from the time of dinosaurs.
They are VERY difficult to grow.
==
Empathy is hard-wired into the mind, study finds
People with a certain type of brain damage showed less aversion to hurting
others.
Damage to the part of the brain that controls social emotions changes the way
people respond to thorny moral problems, demonstrating the role of empathy and
other feelings in life-or-death decisions.
Asked to resolve hypothetical dilemmas such as tossing a person from a bridge
into the path of a trolley to save five others people with damage to their
ventromedial prefrontal cortex tended to sacrifice one life to save many,
according to a study published Wednesday by the journal Nature.
People with intact brains were far less likely to kill or harm someone when
confronted with the same scenarios.
The study, funded by the National Institutes of Health, the National Science
Foundation and private sources, suggests that an aversion to hurting others is
hard-wired into the brain.
"Part of our moral behavior is grounded in a specific part of our brains,"
said Dr. Antonio Damasio, one of the study's lead authors and director of the
Brain and Creativity Institute at USC.
The findings could not be used to predict actual behavior, Damasio said,
because the scenarios presented in the study were unrealistic. More research
is needed to determine if people with and without brain damage would react
differently when faced with real-world dilemmas.
A finding linking a specific type of brain damage to day-to-day moral behavior
could have legal implications in criminal cases. But researchers said the study
was meant to explore the psychological underpinnings of moral actions, not to
characterize decisions as right or wrong.
The ventromedial prefrontal cortex processes feelings of empathy, shame,
compassion and guilt. Damage to this part of the brain, which occupies a small
region in the forehead, causes a diminished capacity for social emotions but
leaves logical reasoning intact.
Researchers from USC, the University of Iowa, Harvard University and Caltech
posed 50 hypothetical scenarios to six people whose ventromedial prefrontal
cortices were damaged by strokes or tumors. Their responses were compared to
those given by 12 people without brain damage and 12 others with damage in
brain areas that regulate other emotions, such as fear.
Researchers found no difference among groups in their responses to scenarios
with no moral content, such as turning a tractor left to harvest turnips.
Scenarios that did not require participants to directly kill or harm someone
elicited very similar responses among the groups. For example, people said
they would classify personal expenses as business expenses to lower their
taxes.
Additionally, members of all groups rejected decisions that would harm someone
for the personal benefit of another, such as killing a newborn because a parent
couldn't care for the infant.
But people with damage to their ventromedial prefrontal cortex were about
three times as likely to sacrifice one person for the greater good compared to
people without brain damage or those with damage in a different part of their
brains.
Joshua D. Greene, a Harvard psychologist not involved in the research, said
the study showed that moral judgment was shaped by two brain systems one
focused on intuitive emotional responses and another that controlled cognition.
"When one of those systems is compromised, decisions are skewed," he said.
Mirella Dapretto, associate professor of psychiatry at the UCLA
Ahmanson-Lovelace Brain Mapping Center, said the brain might not work so
simply.
"One reason these people may have the guts to push someone off a bridge is
that they don't comprehend how their actions would be evaluated by others,"
she said.

==
Jurassic Crocodile Unearthed in Oregon
The fossil of an ancient amphibious reptile with a crocodile's body and a
fish's tail has been unearthed in Oregon. Scientists believe the creature's
remains were transported by geologic processes nearly 5,000 miles away from
where it originally died more than 100 million years ago.
The new fossil is the oldest crocodilian ever unearthed in Oregon and one of
the few to be unearthed on this side of the Pacific. The hybrid animal is
thought to be a new species within the genus Thalattosuchia, a group of
crocodilians living during the age of dinosaurs.
The reptile roamed a tropical environment in Asia about 142 to 208 million
years ago. Called a Thalattosuchian, the amphibious creature
represents an early milestone in evolutionary history, marking a transition
during which these reptiles moved from being semi-aquatic to wholly ocean
species.
Rocky ride
Scientists uncovered the remains of the six- to eight-foot-long
reptile in Jurassic rock on private property in the Snowshoe Formation of the
Izee Terrane, a rock formation in Oregon. They knew the croc came from Asia
due to distinct anatomical features, such as the way its ribs were connected
to the rest of its body.
The rock-entombed animal migrated eastward from perhaps Japan via continental
drift, a theory of land movement in geological time, suggests William Orr,
part of the fossil-discovery team and director of the Thomas Condon State
Museum of Fossils at the University of Oregon.
During ancient times, the Pacific Ocean was much wider than it is today, and
Orr suggests the rocky ride could have taken as long as 100 million years
before reaching North America.
This idea is kind of profound, that you can move pieces of the Earths real
estate about the globe, Orr told LiveScience.
Into the ocean
Like modern-day crocodilians, the creature sported both land-lubbing and
ocean-faring equipment. It had short, stubby legs, which the scientists say
would have allowed it to creep easily along the ground and lay eggs.
But the amphibious Thalattosuchia was also at home in the water. With webbed
feet and a fishs tail, the reptile was likely a swift swimmer that could pulse
through the water in search of aquatic prey.
The thing that makes this creature unique is its tail, Orr said. Unlike todays
reptiles, the creature had a shark-like tail, an indication of its ability to
maintain itself in a marine environment.
[The animal] was awfully close to being purely aquatic, Orr said.

==
Experimental Models of Primitive Cellular Compartments: Encapsulation, Growth,
and Division
Martin M. Hanczyc,* Shelly M. Fujikawa,* Jack W. Szostak
==
http://www.actionbioscience.org/evolution/lenski.html
==
BOGOTA, Colombia -- A multicolored bird with reddish-brown and black
eyes has been discovered as a new species in a Colombian cloud forest
accessible only by helicopter, scientists say.
The fist-sized yellow and black Yariguies Brush-Finch, topped with an orange
plume, was found by a Colombian-English ProAves Foundation team high atop the
country's eastern Andean range in Santander province.
Discovery of the bird, named after an Indian tribe that once lived in the
nature reserve where it was found, was published in the Bulletin of the
British Ornithologists' Club.
Colombia, one of the most ecologically diverse countries in the world, has
about 1,800 species of bird.
"The description of a new bird is a rare event," said expedition member Blanca
Huertas of The Natural History Museum in London. "However, this is just the
first of several new species that we will be describing from the Yariguies
mountains, including several new butterflies."
Legend has it that the Yariguies tribe committed mass suicide to avoid
enslavement by Spanish conquistadors.
==
Mouse
A previously unknown type of mouse has been discovered on the
island of Cyprus, apparently the first new terrestrial mammal species
discovered in Europe in decades.
The living fossil'' mouse has a bigger head, ears, eyes and teeth than other
European mice and is found only on Cyprus, Thomas Cucchi, a research fellow at
Durham University in northeast England, said Thursday. Genetic tests confirmed
that the new mouse was a new species and it was named Mus cypriacus, or the
Cypriot mouse, he said.
His findings appeared in the peer-reviewed journal Zootaxa, an international
journal for animal taxonomists.
The biodiversity of Europe has been combed through so extensively since
Victorian times that new mammal species are rarely found there, and few
scientists had expected new creatures as large as mice to be discovered on the
continent.
New mammal species are mainly discovered in hot spots of biodiversity like
Southeast Asia, and it was generally believed that every species of mammal in
Europe had been identified,'' Cucchi said. This is why the discovery of a new
species of mouse on Cyprus was so unexpected and exciting.''
Cucchi said a bat discovered in Hungary and Greece in 2001 was the last new
living mammal found in Europe. No new terrestrial mammal has been found in
Europe for decades, he said.
Cucchi compared the new mouse's teeth with those from mouse fossils collected
by paleontologists. The comparison showed the new mouse had colonized and
adapted to the Cypriot environment several thousand years before the arrival
of man, the university said in a statement.
The discovery indicated that the mouse survived man's arrival on the island
and now lived alongside common European house mice, whose ancestors had
arrived with man during the Neolithic period, the university said.
All other endemic mammals of Mediterranean islands died out following the
arrival of man, with the exception of two species of shrew. The new mouse of
Cyprus is the only endemic rodent still alive, and as such can be considered
as a living fossil,'' Cucchi, a Frenchman, said in a telephone interview.
Shrews are small mammals that resemble mice but have a long, pointed snout and
eat insects.
Cucchi, an archaeologist and expert on the origin and human dispersal of house
mice, found the new species of mouse while working in Cyprus in 2004. He was
examining the archaeological remains of mice teeth from the Neolithic period
and comparing them with those of four known modern-day European mice species,
to determine if the house mouse was the unwelcome byproduct of human
colonization of the island 10,000 years ago, the university said.
The discovery of this new species and the riddle behind its survival offers a
new area of study for scientists studying the evolutionary process of mammals
and the ecological consequences of human activities on island biodiversity,''
Cucchi said.
==
Bees
The discovery of the oldest bee fossil supports the theory that bees evolved
from wasps, scientists reported today.
The 100 million-year-old fossil was found in a mine in the Hukawng Valley of
Myanmar (Burma) and preserved in amber. Amber, which begins as tree sap, often
traps insects and plant structures before they fossilize.
"This is the oldest known bee we've ever been able to identify, and it shares
some of the features of wasps," said lead author George Poinar, a researcher
from Oregon State University. "But overall it's more bee than wasp, and gives
us a pretty good idea of when these two types of insects were separating on
their evolutionary paths."
The quarter-inch fossil shares traits of the carnivorous wasp such as narrow
hind legs while exhibiting branched hairs on its leg, a characteristic of the
modern bee that allows pollen collection.
Around the same time the bee was trapped, plants that rely on mechanisms other
than the wind to spread their seeds, started expanding and diversifying. Prior
to that, the world was mostly green with conifer trees that depended on the
wind for pollination.
"Flowering plants are very important in the evolution of life," Poinar said.
"They can reproduce more quickly, develop more genetic diversity, spread more
easily and move into new habitats. But prior to the evolution of bees they
didn't have any strong mechanism to spread their pollen, only a few flies and
beetles that didn't go very far."
==
Humans left chimps behind in 'evolution's playground'
MICRO-RNA, snippets of RNA that control gene expression, could be what makes
the difference between us and chimps.
Variation between individuals, in traits ranging from pigment to behaviour, is
the raw material of evolution. The difference can be down to very subtle
changes: the genes involved may code for exactly the same proteins but make
them at other places and times. So could micro-RNA be the determining factor?
Micro-RNAs are a mere 22 nucleotides long and block the messenger RNA that
translates DNA into protein. This allows them to fine-tune gene expression.
Discovered only a few years ago, micro-RNA has been shown to determine what
cell types form, and, for example, whether sheep become muscular or puny.
Now, researchers at the Hubrecht Laboratory in Utrecht, the Netherlands, have
combed painstakingly through the RNA in human and chimp brains, and found 447
new micro-RNAs, more than doubling the number discovered so far (Nature
Genetics, DOI: 10.1038/ng1914). Some were expressed very rarely.
"The brain has 10,000 cell types," says team member Edwin Cuppen. "Perhaps
that is because of all these micro-RNAs." Many were unique to chimps and
humans, and some only to humans. So even though we share most of our DNA with
chimps, small genetic changes that fine-tune its expression might account for
the radical differences in our brains. "This is the playground of evolution,"
says Cuppen
===
Neanderthals may have given the modern humans who
replaced them a priceless gift -- a gene that helped them develop superior
brains, U.S. researchers reported Tuesday.
And the only way they could have provided that gift would have been by
interbreeding, the team at the Howard Hughes Medical Institute and the
University of Chicago said.
Their study, published in the Proceedings of the National Academy of Sciences,
provides indirect evidence that modern Homo sapiens and so-called Neanderthals
interbred at some point when they lived side by side in Europe.
"Finding evidence of mixing is not all that surprising. But our study
demonstrates the possibility that interbreeding contributed advantageous
variants into the human gene pool that subsequently spread," said Bruce Lahn,
a Howard Hughes Medical Institute researcher at the University of Chicago who
led the study.
Scientists have been debating whether Neanderthals, who died out about 35,000
years ago, ever bred with modern Homo sapiens. Neanderthals are considered
more primitive, with robust bones but a smaller intellect than modern humans.
Lahn's team found a brain gene that appears to have entered the human lineage
about 1.1 million years ago, and that has a modern form, or allele, that
appeared about 37,000 years ago -- right before Neanderthals became extinct.
"The gene microcephalin (MCPH1) regulates brain size during development and
has experienced positive selection in the lineage leading to Homo sapiens,"
the researchers wrote.
Positive selection means the gene conferred some sort of advantage, so that
people who had it were more likely to have descendants than people who did
not. Lahn's team estimated that 70 percent of all living humans have this type
D variant of the gene.
"By no means do these findings constitute definitive proof that a Neanderthal
was the source of the original copy of the D allele. However, our evidence
shows that it is one of the best candidates," Lahn said.
The researchers reached their conclusions by doing a statistical analysis of
the DNA sequence of microcephalin, which is known to play a role in regulating
brain size in humans. Mutations in the human gene cause development of a much
smaller brain, a condition called microcephaly.
By tracking smaller, more regular mutations, the researchers could look at
DNA's "genetic clock" and date the original genetic variant to 37,000 years
ago.
They noted that this D allele is very common in Europe, where Neanderthals
lived, and more rare in Africa, where they did not. Lahn said it is not yet
clear what advantage the D allele gives the human brain.
"The D alleles may not even change brain size; they may only make the brain a
bit more efficient if it indeed affects brain function," Lahn said.
Now his team is looking for evidence of Neanderthal origin for other human
genes.
It is an amazing "discovery" if it were to come true, however i think the
assumptions must have stronger evidences in order to be accepted as true.
Until now the only evidences are that the new type of gene came around 37,000
just before Neanderthals died out and that the gene is more wide spreed on
Europe than in Africa.
==
Meet your new evolutionary cousin, the sea urchin. By analyzing the newly
sequenced genome of the spineless creature, an international team of
scientists found just how much we have in common with them. The research could
lead to new drugs for human ills.
The sea urchin is surprisingly similar to humans," said co-director of the sea
urchin sequencing project George Weinstock, of Baylor College of Medicine. "Sea
urchins don't look any more like humans than fruit flies, but about 70 percent
of sea urchin genes have a human counterpart whereas only about 40 percent of
fruit fly genes do."
In a special report detailed in the Nov. 9 issue of the journal Science,
research teams describe the genome of the purple sea urchin, revealing not
only human-urchin similarities but also features such as the urchins immune
system, which far surpasses that of humans.
A sea urchins pincushion look comes from a round inner shell, which is covered
with spikes for spearing food and tiny tube feet used for creeping along the
seafloor. They belong to the phylum Echinodermata, which includes starfish and
sea cucumbers, whereas humans belong to the phylum Chordata, or all animals
with backbones. Both the echinoderms and chordates belong to a larger group
called the deuterostomes.
This relationship means sea urchins can serve as a model for understanding how
the group of animals that includes humans split off and evolved different
traits. For the genome project, scientists collected DNA from the sperm of a
male California purple sea urchin, a species found along the west coast of the
United States from Baja to Alaska.
After identifying 23,300 genes made from 814 million letters of DNA code taken
from the California purple urchin (Strongylocentrotus purpuratus), the team of
scientists found that 7,077 of them were also found in humans.
Analysis of the sea urchin genomethe first-ever chordate to be sequenced
revealed a surprisingly unique and complex immune system, which could explain
their lengthy life spans of up to 100 years.
They live as long as we do, maybe longer, and thus must protect themselves,"
Weinstock told LiveScience. "So an elaborate set of defense genes would be
necessary. What was absolutely unexpected was the finding that they had
expanded the innate immunity branch of the immune system."
Whereas humans have an acquired immune system, in which our body must learn
how to attach and destroy invaders once they enter the body, sea urchins are
hard wired to detect foreign bacteria and viruses and begin an attack.
This rich toolbox of sea urchin genes could lead to new drugs for combating
infectious diseases. In fact, sea urchins carry genes associated with many
human diseases, including muscular dystrophy and Huntington's disease
The sequence also helped scientists uncover complexities belied by the urchins
simple exterior. Sea urchins lack eyes and ears, but they sport genes
associated with taste and smell, hearing and balance, the study found.
"Nobody would've predicted that sea urchins have such a robust gene set for
visual perception," said Gary Wessel, a member of the Sea Urchin Genome
Sequencing Consortium, of Brown University.
Some of the visual sensory proteins are clustered on an appendage known as the
tube foot and is thought to aid processing of sensory of information. It is
remarkable that the same sensory proteins are used in organs with such
different structures in sea urchins and man," Weinstock said.
It's not clear, however, how the spindly creatures use the vision proteins.
There is not a lot of light at the bottom of the ocean so it is not clear what
they might be seeing,'" Weinstock said. "This is certainly an area that will be
studied intensively as a result of the genome project.
==
Humans and their close Neanderthal relatives began diverging from a common
ancestor about 700,000 years ago, and the two groups split permanently some
300,000 years later, according to two of the most detailed analyses of
Neanderthal DNA to date.
Using different techniques, two teams of scientists separately sequenced large
chunks of DNA extracted from the femur of a 38,000-year-old Neanderthal
specimen found in a cave 26 years ago in Croatia. One team sequenced more than
one million base pairs and the other 65,000 pairs of the genome.
The achievements could help shed light on the evolution of our own species,
and it paves the way for building a complete library of the Neanderthal
genome, the scientists say.
In popular imagination, Neanderthals are often portrayed as prehistoric brutes
who became outsmarted by a more advanced species, humans, emerging from Africa.
But excavations and anatomical studies have shown Neanderthals used tools, wore
jewelery, buried their dead, cared for their sick, and possibly sang or even
spoke in much the same way that we do. Even more humbling, perhaps, their
brains were slightly larger than ours.
The results from the new studies confirm the Neanderthal's humanity, and show
that their genomes and ours are more than 99.5 percent identical, differing by
only about 3 million bases.
"This is a drop in the bucket if you consider that the human genome is 3
billion bases," said Edward Rubin of the Lawrence Berkeley National
Laboratory, who led one of the research teams.
For comparison, the genomes of chimpanzees, our closest living relatives,
differ from humans by about 30 million to 50 million base pairs.
The findings also appear to refute speculations by some scientists that
Neanderthals and humans interbred in more recent times. "We see no evidence of
mixing 30,000 to 40,000 years ago in Europe," Rubin said. "We don't exclude it,
but from the data that we have, we have no evidence that pages were ripped from
one genome and put in the other."
One of the biggest challenges in sequencing Neanderthal DNA is finding a bone
sample that hasn't been too contaminated by human handling. Fortunately, the
femur fragment used in the studies was relatively small and uninteresting,
causing it to be largely overlooked.
The femur "was thrown in a big box of uninformative bones and not handled very
much," said Svante Paabo of the Max Planck Institute for Evolutionary
Anthropology in Germany, leader of the other sequencing project. "Whereas more
interesting boneswhere you can study the muscle attachment and the morphology
of Neanderthalshad been extensively cleaned and handled and thus tend to be
much more contaminated."
The researchers also relied on other clues, such as chemical damage unique to
ancient DNA, to help verify that the genetic material was indeed Neanderthal.
"One of the crucial things is that we feel confident that the DNA we have,
which we're calling Neanderthal, is truly Neanderthal," Rubin said.
The success of the two team's sequencing projects were made possible by recent
advances in DNA sequencing technology, which now allow scientists to sequence
DNA over 100 times faster than in the past.
Paabo's team recovered more than a million Neanderthal base pairs using a new
automated technique called "pyrosequencing." In this process, DNA fragments
are attached to tiny artificial beads, sequenced, and then matched to similar
sections on human chromosomes.
Rubin's team employed "metagenomics," which involves integrating short
fragments of extracted Neanderthal DNA into the genomes of bacteria. The
Neanderthal DNA gets amplified as the bacteria divide, and then scientists
pluck out human-matching bases using "probes" made with snippets of human DNA.
The researchers say their achievements mark the "dawn of Neanderthal
genomics," and they estimate that further advances in DNA sequencing
technology could allow the completion of a very rough draft of the entire
Neanderthal genome within two years.

"There's no question that we're going to have a Neanderthal genome, and
likely, we're going to have several Neanderthal genomes," Rubin said. The team
hopes to extract and sequence DNA from the bones of other individuals and to
complete several drafts of the Neanderthal genome.

A complete Neanderthal genome would help scientists identify the genetic
changes in our own genome that set us apart from other hominids.

The comparison between recently sequenced chimpanzee genomes and ours is
already shedding light on the evolutionary changes our ancestors went through
to make them less ape-like. But because chimps and humans began diverging some
6.5 million years ago, examination of their genome cannot reveal what happened
in the final stretches of our own evolution.

"Humans went through several stages of evolution in the last 400,000 years,"
said study co-author Jonathan Pritchard of the University of Chicago. "If we
can compare humans and Neanderthals genomes, then we can possibly identify
what the key genetic changes were during that final stage of human evolution."

A completed genome will also reveal new insights about Neanderthals, who
disappeared mysteriously about 30,000 years ago.

"In having the Neanderthal genome sequence ...we're going to learn about the
biology, learn about things that we could never learn from the bones and the
artifacts that we have," Rubin said.

The results of Rubin's team are detailed in the Nov. 16 issue of the journal
Nature; Paabo's team's results are detailed in the Nov. 17 issue of the
journal Science.

==
Greatest Mass Extinction Gave Oceans a Face Lift
The largest extinction in Earth's history not only wiped out 95 percent of sea
creatures and 70 percent of land animals, it also gave the oceans a fundamental
"face lift," according to a new study.
Before the end-Permian mass extinction 250 million years ago, the seas were
home to a balance of both ecologically simple communities and complex ones.
Following the extinction, complex communities displaced simple ones, coming to
outnumber them three-to-one, a pattern that prevails today
It reflects the current dominance of complex, mobile organisms, such as snails
and crabs, and the decreased diversity of simple, stationary organisms such as
sea lilies, which filter nutrients from the water.
In communities with a simple structure, organisms just pull resources from a
common pool in a similar way without interacting with one another or their
environment. "It's a simple system when everyone comes in and they grab their
portion of the pie, and the pie doesn't change," said lead researcher Peter
Wagner of The Field Museum in Chicago.
"The other is a more complicated system where organisms come in and they take
a piece of the pie, but then they put something back into the pie for other
organisms to take," Wagner told LiveScience.
Until now, scientists had assumed that while complexity in general had slowly
ramped up over time, the structure of communities had remained somewhat
constant.
This drastic change in marine structure has eluded scientists for decades.
Previous research relied on single numbers, such as the number of species
alive during a certain time, to track the diversity of marine life.
For example, let's say there are two communities, each containing five species
and a total of 300 individuals. In one community all species are equally
common, each containing 60 individuals, while in the second community one
species greatly outnumbers the other four. Counting the number of species
would miss this subtle difference. The scientists relied on the Paleobiology
Database, which catalogues studied fossil records from nearly 1,200 locations
representing the past 540 million years.
In complex communities, the organisms interact in many ways and depend on one
another for food or living quarters, just like a tree provides many homes for
animals like birds and ants. The shift toward complexity is what could have
allowed a greater number of different species to exist within a limited amount
of space with limited resources.
"You are cramming more species into a given patch of real estate for a given
number of bodies," said David Jablonski of the University of Chicago, who was
not involved in the study.
The scientists found the results held even after taking into account factors
that could have biased the data, including how fossils are preserved or
collected. Still, the study isn't foolproof, since the fossil records came
from various locations with different collection methods, according to Doug
Erwin of the Smithsonian Institution, who was not involved in the work.
The research does open the door for follow-up studies. "There's always more
work to be done. But this is a very interesting, and to me very intriguing,
first-cut look at this whole sweep of geologic time that suggests there's this
changeover," Jablonski said.
==
Human evolution
A surprisingly recent instance of human evolution has been detected among the
peoples of East Africa. It is the ability to digest milk in adulthood,
conferred by genetic changes that occurred as recently as 3,000 years ago, a
team of geneticists has found.
The finding is a striking example of a cultural practice the raising of dairy
cattle feeding back into the human genome. It also seems to be one of the
first instances of convergent human evolution to be documented at the genetic
level. Convergent evolution refers to two or more populations acquiring the
same trait independently.
Throughout most of human history, the ability to digest lactose, the principal
sugar of milk, has been switched off after weaning because there is no further
need for the lactase enzyme that breaks the sugar apart. But when cattle were
first domesticated 9,000 years ago and people later started to consume their
milk as well as their meat, natural selection would have favored anyone with a
mutation that kept the lactase gene switched on.
Such a mutation is known to have arisen among an early cattle-raising people,
the Funnel Beaker culture, which flourished some 5,000 to 6,000 years ago in
north-central Europe. People with a persistently active lactase gene have no
problem digesting milk and are said to be lactose tolerant.
Almost all Dutch people and 99 percent of Swedes are lactose-tolerant, but the
mutation becomes progressively less common in Europeans who live at increasing
distance from the ancient Funnel Beaker region.
Geneticists wondered if the lactose tolerance mutation in Europeans, first
identified in 2002, had arisen among pastoral peoples elsewhere. But it seemed
to be largely absent from Africa, even though pastoral peoples there generally
have some degree of tolerance.
A research team led by Sarah Tishkoff of the University of Maryland has now
resolved much of the puzzle. After testing for lactose tolerance and genetic
makeup among 43 ethnic groups of East Africa, she and her colleagues have
found three new mutations, all independent of each other and of the European
mutation, which keep the lactase gene permanently switched on.
The principal mutation, found among Nilo-Saharan-speaking ethnic groups of
Kenya and Tanzania, arose 2,700 to 6,800 years ago, according to genetic
estimates, Dr. Tishkoffs group is to report in the journal Nature Genetics on
Monday. This fits well with archaeological evidence suggesting that pastoral
peoples from the north reached northern Kenya about 4,500 years ago and
southern Kenya and Tanzania 3,300 years ago.
Two other mutations were found, among the Beja people of northeastern Sudan
and tribes of the same language family, Afro-Asiatic, in northern Kenya.
Genetic evidence shows that the mutations conferred an enormous selective
advantage on their owners, enabling them to leave almost 10 times as many
descendants as people without them. The mutations have created one of the
strongest genetic signatures of natural selection yet reported in humans, the
researchers write.
The survival advantage was so powerful perhaps because those with the
mutations not only gained extra energy from lactose but also, in drought
conditions, would have benefited from the water in milk. People who were
lactose-intolerant could have risked losing water from diarrhea, Dr. Tishkoff
said.
Diane Gifford-Gonzalez, an archaeologist at the University of California,
Santa Cruz, said the new findings were very exciting because they showed the
speed with which a genetic mutation can be favored under conditions of strong
natural selection, demonstrating the possible rate of evolutionary change in
humans.
The genetic data fitted in well, she said, with archaeological and linguistic
evidence about the spread of pastoralism in Africa. The first clear evidence
of cattle in Africa is from a site 8,000 years old in northwestern Sudan.
Cattle there were domesticated independently from two other domestications, in
the Near East and the Indus valley of India.
Both Nilo-Saharan speakers in Sudan and their Cushitic-speaking neighbors in
the Red Sea hills probably domesticated cattle at the same time, since each
has an independent vocabulary for cattle items, said Dr. Christopher Ehret, an
expert on African languages and history at the University of California, Los
Angeles. Descendants of each group moved southward and would have met again in
Kenya, Dr. Ehret said.
Dr. Tishkoff detected lactose tolerance among both Cushitic speakers and
Nilo-Saharan groups in Kenya. Cushitic is a branch of Afro-Asiatic, the
language family that includes Arabic, Hebrew and ancient Egyptian.
Dr. Jonathan Pritchard, a statistical geneticist at the University of Chicago
and the co-author of the new article, said that there were many signals of
natural selection in the human genome, but that it was usually hard to know
what was being selected for. In this case Dr. Tishkoff had clearly defined the
driving force, he said.
The mutations Dr. Tishkoff detected are not in the lactase gene itself but a
nearby region of the DNA that controls the activation of the gene. The finding
that different ethnic groups in East Africa have different mutations is one
instance of their varied evolutionary history and their exposure to many
different selective pressures, Dr. Tishkoff said.
There is a lot of genetic variation between groups in Africa, reflecting the
different environments in which they live, from deserts to tropics, and their
exposure to very different selective forces, she said.
People in different regions of the world have evolved independently since
dispersing from the ancestral human population in northeast Africa 50,000
years ago, a process that has led to the emergence of different races. But
much of this differentiation at the level of DNA may have led to the same
physical result.
As Dr. Tishkoff has found in the case of lactose tolerance, evolution may use
the different mutations available to it in each population to reach the same
goal when each is subjected to the same selective pressure. I think its
reasonable to assume this will be a more general paradigm, Dr. Pritchard said.
=
GENEVA, Switzerland Scientists have discovered at least 52 new species
of animals and plants on the southeast Asian island of Borneo since 2005,
including a catfish with protruding teeth and suction cups on its belly to
help it stick to rocks, WWF International said Tuesday.
"The more we look the more we find," said Stuart Chapman, WWF International
coordinator for the study of the "Heart of Borneo," a 85,000-square-mile rain
forest in the center of the island where several of the new species were
found. "These discoveries reaffirm Borneo's position as one of the most
important centers of biodiversity in the world."
Much of Borneo, which is shared by Indonesia, Malaysia and the sultanate of
Brunei, is covered by one of the world's last remaining rain forests.
The discoveries bring the total number of species newly identified on the
island to more than 400 since 1996, according to WWF, known in North America
as the World Wildlife Fund.
Other creatures discovered between July 2005 and September 2006 were six
Siamese fighting fish, whose unique colors and markings distinguish them from
close relatives, and a tree frog with bright green eyes.
The catfish, which can be identified by its pretty color pattern, is named
glyptothorax exodon, a reference to the teeth that can be seen even when the
its mouth is closed. The suction cups on its belly enable it to stick to
smooth stones while facing the current of Indonesia's turbulent Kapuas River
system.
On the Malaysian part of the island, slow-flowing blackwater streams and peat
swamps are home to the paedocypris micromegethes, which is 0.35 inch long.
The creature, which gets its name from the Greek words for children and small,
is tinier than all other vertebrate species on Earth except for its slightly
more minuscule cousin, a 0.31-inch-long fish found on the Indonesian island of
Sumatra, according to WWF.
The discoveries further highlight the need to conserve the habitat and species
of Borneo, where the rain forest continues to be threatened by rubber, palm oil
and pulp production, WWF said.
"The remote and inaccessible forests in the Heart of Borneo are one of the
world's final frontiers for science, and many new species continue to be
discovered here," said Chapman.
He added that the forests were also vital because they were the source the
island's major rivers acting as a natural break to fires burning in the
lowlands this year.
Jane Smart, who heads the World Conservation Union's species program, said the
discovery of 52 species within a year in Borneo was a "realistic" number given
that scientists guess there are about 15 million species on Earth. "There are
still many more species that remain to be discovered there," she said.
Borneo is particularly important for biodiversity because the island has a
high number of endemic species, creatures which only occur in that one place,
she told The Associated Press. "So if you wipe out a small area, you're going
to wipe out a lot of the species' habitat," she said, adding that once these
creatures are destroyed, they are gone forever.
"This is a real concern when forests are ripped out for rubber plantations or
oil palm plantations," Smart said.
==
Bats
In the world of bats, there was only one known sucker-foot. Now there are two.
Scientists have discovered a second species of bat with adhesive organs, or
suckers, attached to its thumbs and hind feet, allowing the creatures to climb
and cling upright to smooth tree leaves.
The new species, Myzopoda schliemanni, discovered in the dry western forests
of Madagascar, belongs to a family of bats, Myzopoda, found in Madagascar and
nowhere else in the world. Previously, scientists knew only of a sister
species, Myzopoda aurita which lives only in the humid eastern forests of
Madagascar.
Both species are spotted where broad-leafed plants, especially the Travelers
Palm, are plentiful. The bats often roost in the slick greens during the day.
Up to now, sucker-footed bats were considered endangered because there was
only one known species in the family and because of their limited distribution
worldwide. But the finding of the second sucker-footed species means their
range is broader than previously thought. And given the discovery of the new
bat in a dry forest, members of the sucker-footed bat family could survive
even if tropical forests are lost to deforestation, a huge issue in Madagascar
where less than 10 percent of the countrys original forest cover remains
"For now, we do not have to worry as much about the future of Myzopoda," said
Steven M. Goodman, Field Museum biologist and lead author of a study published
online in the journal Mammalian Biology. "We can put conservation efforts on
behalf of this bat on the backburner because it is able to live in areas that
have been completely degraded, contrary to what is indicated or inferred in
the current literature."
Goodman and colleagues believe that because of the similarities between the
two Myzopoda, one species evolved from another, most likely after the bat
dispersed from east to west.
Biodiversity in Madagascar, an island off the eastern coast of Africa, is one
of the most critically threatened in the world. The nation has one of the
highest levels of endemism worldwide (endemism is the condition when a species
is found only in one location or region in the world).
==
Neanderthals
A skull found in a cave in Romania includes features of
both modern humans and Neanderthals, possibly suggesting that the two may have
interbred thousands of years ago.
Neanderthals were replaced by early modern humans. Researchers have long
debated whether the two groups mixed together, though most doubt it. The last
evidence for Neanderthals dates from at least 24,000 years ago.
The skull bearing both older and modern characteristics is discussed in a
paper by Erik Trinkaus of Washington University in St. Louis. The report
appears in Tuesday's issue of Proceedings of the National Academy of Sciences.
The skull was found in Pestera cu Oase -- the Cave with Bone -- in
southwestern Romania, along with other human remains. Radiocarbon dating
indicates it is at least 35,000 years old and may be more than 40,000 years
old.
The researchers said the skull had the same proportions as a modern human head
and lacked the large brow ridge commonly associated with Neanderthals. However,
there were also features that are unusual in modern humans, such as frontal
flattening, a fairly large bone behind the ear and exceptionally large upper
molars, which are seen among Neanderthals and other early hominids.
"Such differences raise important questions about the evolutionary history of
modern humans," said co-author Joao Zilhao of the University of Bristol,
England.
It could reflect a case in which ancient traits reappear in a modern human, or
it could indicate a mixture of populations, Zilhao said. Or it simply may be
that science has not been able to study enough early modern people to
understand their diversity.
Dr. Richard Potts of the Smithsonian's National Museum of Natural History
noted that the skull represents the earliest modern human ever found in Europe.
It's a big deal in that sense, he said, but the combination of characteristics
do not necessarily indicate interbreeding between populations.
Overall there is no strong evidence for mixing of Neanderthal and modern human
populations and "this doesn't add any," said Potts, who was not part of the
research team.
None of the features cited as unusual in modern humans is exclusively
Neanderthal, Potts said. Rather, they could be features passed down from
earlier populations in Africa.
The field work that uncovered the skull was conducted in 2004 and 2005.
Meanwhile, a research team led by Svante Paabo of the Max Planck Institute for
Evolutionary Anthropology in Leipzig, Germany, is trying to map the Neanderthal
genome in hopes of better understanding any possible relationship to modern
people.
==
Fossils
The discovery of spherical fossils that resemble tiny baseballs could reveal
how the earliest known egg-laying organism developed from embryo to adulthood.
In 1998, researchers discovered thousands of 600-million-year-old fossilized
embryos in the Doushantuo Formation, a fossil deposit in South China. Two
years later, the same team unearthed fossils of a tubular coral-like animal,
called Megasphaera ornata, which appeared to be grown-up versions of the
embryos discovered earlier.
The case for a relationship between the two fossil types now has been
strengthened by the recent discovery of about 80 intermediate-stage fossils
that have traits in common with both groups.
The finding, to be detailed in the February issue of the journal Geology,
could provide the missing link between egg and adult versions of one of Earths
earliest animals.
Externally, the early and intermediate stage embryos appear very similar. They
are about the same sizeabout 0.02 inches wide or about as big as a grain of
sandand both have similar outer coverings, called embryonic envelopes.
Its inside that the real differences become apparent. Using an imaging
technique called microfocus X-ray computed tomography (microCT), the
researchers virtually peeled away the envelope to reveal the new fossils
insides.
Inside, they found three-dimensional spiral structures that look like grooves
on a screw.
The only signs of these coils on the outside of the embryos are tiny holes
arranged in a pattern resembling stitches on a baseball. Traces of these coils
are also found on the external coverings of the adult fossils.
Some of the intermediate embryos also appeared to be unfurling; the
researchers speculate that if the process had continued, the embryos would
distend like a stretched slinky or a flattened fuselli noodle into the tubular
adult form.
The new fossils provide some suggestive evidence that these two groups of
fossils are linked developmentally, said study team member Shuhai Xiao of
Virginia Tech.
The new embryos could help shed light on how ancient animals developed and
whether the process was similar to that of living organisms. Ancient embryos
and embryos from modern day animals are remarkably similar, but the
developmental journey from egg to adult for ancient organisms is still
shrouded in mystery.
Now we have isolated dots. We need to connect them and make a complete story
before we can say anything about their evolutionary relationship, Xiao told
LiveScience.
The researchers are hopeful that they can find later stages of embryo
development for M. ornata. I think this is an encouraging sign that later
embryonic stages may still be preserved in this rock, Xiao said. If we keep
looking, we may even find a developmental sequence.


==
New Rat Species
If you think rats only dwell in the abysses of smelly subway stations and
trashcans, think again. Scientists have spotted a squirrel-sized rodent in the
lofty cloud forests of Peru.
The pudgy small mammal is a brand-new species. Observations and preliminary
genetic analyses suggest that the rodents nearest relatives are a group called
spiny rats, which are restricted to lowlands. The new rodent's discoverers say
this suggests that spiny rats evolved from this Andean species.
The nocturnal, climbing rodent (Isothrix barbarabrownae) has a broad blocky
head, bushy tail and a coat of dense, soft fur that is decorated by a black
crest on its crown, nape and shoulders.
Nothing known from those forests bears any resemblance to this thing, said
lead scientist Bruce Patterson of the Field Museum in Chicago. In appearance,
its like a chunky squirrel.
Equipped with a headlamp, Patterson spotted the rodent several years ago at
about midnight during a survey in Perus Manu National Park and Biosphere
Reserve Mountains, along the eastern slope of the Andes.
[The rodent] was just cooking along the trail, and actually I heard it slip
down a moss-encrusted wall. Thats when I became aware of it, Patterson told
LiveScience.
Along the rat trail at an altitude of 6,200 feet, Patterson snagged the
animal, which is now a dead specimen back at his laboratory at the museum.
The discovery helps to solve a riddle among ecologists: Why would some spiny
rats, called bush-tailed tree rats, that reside in the warm, humid lowlands of
the Amazon wear such thick coats of fur?
Theres a family called the spiny rats, and it includes [rats] that are so
spiny they are like porcupines as well as a few soft-haired members, Patterson
said. Now the soft-haired members had never really made sensewhy there would be
both spiny and soft-haired members in the lowland forestuntil now.
A furry coat makes sense for organisms that live in the cool, damp cloud
forests. Patterson suggests the spiny rats first lived in the chilly mountains
before they radiated into the lowlands. Some of the rats have not evolved yet
to shed their fur for a more weather-appropriate cover.
Most scientists have assumed that since the Andes is such a relatively young
mountain chain, its inhabitants must have moved up from lowland areas.
Pattersons team will continue to run genetic tests on the specimen in an
effort to determine which came firstthe mountain rats or the warm-weather ones.
The research is detailed in the current issue of the journal Neotropical
Mammalogy.
==
http://philosophy.wisc.edu/sober/what's%20wrong%20with%20id%20qrb%202007.pdf
about ID
==
Labbe P, Berthomieu A, Berticat C, Alout H, Raymond M, Lenormand T, Weill M.
(2007) Independent Duplications of the Acetylcholinesteras e Gene Conferring
Insecticide Resistance in the Mosquito Culex pipiens. Mol Biol Evol. [Epub
ahead of print]

Gene duplication is thought to be the main potential source of material for
the evolution of new gene functions. Several models have been proposed for the
evolution of new functions through duplication, most based on ancient events
(My). We provide molecular evidence for the occurrence of several (at least 3)
independent duplications of the ace-1 locus in the mosquito Culex pipiens,
selected in response to insecticide pressure that probably occurred very
recently (< 40 years ago). This locus encodes the main target of several
insecticides, the acetylcholinesteras e. The duplications described consist of
two alleles of ace-1, one susceptible and one resistant to insecticide, located
on the same chromosome. These events were detected in different parts of the
world and probably resulted from distinct mechanisms. We propose that
duplications were selected because they reduce the fitness cost associated
with the resistant ace-1 allele through the generation of persistent,
advantageous heterozygosis. The rate of duplication of ace-1 in C. pipiens is
probably underestimated, but seems to be rather high.
Notice that this is fresh science, from the date [Epub ahead of print]. The
entire first page and almost all of the second page of results are from 2007.
If you go to page 141 to get the oldest citations, they go back to 1967;
you'll find titles like "Evolution of protamine: a further example of partial
gene duplication" and "Evolution from fish to mammals by gene duplication" and
"Gene duplication and the evolution of enzymes".

There are 2807 papers indexed by PubMed on this subject. Michael Egnor has
been unable to find any of them, and I suspect he has never even looked. The
Discovery Institute may like to trumpet his expertise in neurosurgery as an
indicator of the significance of his dissent from evolutionary biology, but I
think I'd rather trumpet his ignorance of evolutionary biology as an indicator
of the uselessness of the Discovery Institute's list.

TrackBacks
(TrackBack URL for this entry: http://scienceblogs .com/mt/pings/ 33614)

Kimura, M. (1961) "Natural selection as the process of accumulation of genetic
information in adaptive evolution." Genetical Research, 2:127-140.
It demonstrates that natural selection drives an increase the Shannon
information content of the genome, and it's all of forty-six years old.
==
A favorite quote is from J.B.S. Haldane that God must have "an inordinate
fondness for beetles" given that there are some 350,000 species of beetles.
==
The best evidence for evolution is the fact that the human genome contains
many "switched off" sequences that are identical to sequences that
are "switched on" in simpler species.
==
Creationists give a bunch of mathematical mumbojumbo about the odds of cells
forming in the primordial soup,

All of those "calculations" are based on the preposterous assumption
that a complete, modern cell just happened to be flung together at
random. No theory of abiogensis proposes anything so silly. It would
be like calculating the chance that all the apples from the tree would
fall in the same direction (down), and having found out that there
were an infinite number of other directions, calling gravity a
baseless theory.
==
http://www.talkorigins.org/faqs/comdesc/ evidence for evolution. *

http://wiki.cotch.net/index.php/Fossil_Sorting *
==
The sudden appearance of a large self-copying molecule such as RNA
was exceedingly improbable. Energy-driven networks of small molecules
afford better odds as the initiators of life.

Extraordinary discoveries inspire extraordinary claims. Thus James
Watson reported that, immediately after they had uncovered the
structure of DNA, Francis Crick "winged into the Eagle (pub) to tell
everyone within hearing that we had discovered the secret of life."
Their structure--an elegant double helix--almost merited such
enthusiasm. Its proportions permitted information storage in a
language in which four chemicals, called bases, played the same role
as twenty six letters do in the English language.

Further, the information was stored in two long chains, each of which
specified the contents of its partner. This arrangement suggested a
mechanism for reproduction, that was subsequently illustrated in many
biochemistry texts, as well as on a tie that my wife bought for me at
a crafts fair: The two strands of the DNA double helix parted
company. As they did so, new DNA building blocks, called nucleotides,
lined up along the separated strands and linked up. Two double
helices now existed in place of one, each a replica of the original.
The Watson-Crick structure triggered an avalanche of discoveries
about the way in which living cells function today. These insights
also stimulated speculations about life's origins. Nobel Laureate H.
J. Muller wrote that the gene material was "living material, the
present-day representative of the first life," which Carl Sagan
visualized as "a primitive free-living naked gene situated in a
dilute solution of organic matter." In this context, "organic"
specifies material containing bound carbon atoms. Organic chemistry,
a subject sometimes feared by pre-medical students, is the chemistry
of carbon compounds, both those present in life and those playing no
part in life. Many different definitions of life have been proposed.
Muller's remark would be in accord with what has been called the NASA
definition of life: Life is a self-sustained chemical system capable
of undergoing Darwinian evolution.

Richard Dawkins elaborated on this image of the earliest living
entity in his book The Selfish Gene: "At some point a particularly
remarkable molecule was formed by accident. We will call it the
Replicator. It may not have been the biggest or the most complex
molecule around, but it had the extraordinary property of being able
to create copies of itself." When Dawkins wrote these words 30 years
ago, DNA was the most likely candidate for this role. As we shall
see, several other replicators have now been suggested.

When RNA Ruled the World

Unfortunately, complications soon set in. DNA replication cannot
proceed without the assistance of a number of proteins--members of a
family of large molecules that are chemically very different from
DNA. Proteins, like DNA, are constructed by linking subunits, amino
acids in this case, together to form a long chain. Cells employ
twenty of these building blocks in the proteins that they make,
affording a variety of products capable of performing many different
tasks--proteins are the handymen of the living cell. Their most
famous subclass, the enzymes, act as expeditors, speeding up chemical
processes that would otherwise take place too slowly to be of use to
life.

The above account brings to mind the old riddle: Which came first,
the chicken or the egg? DNA holds the recipe for protein
construction. Yet that information cannot be retrieved or copied
without the assistance of proteins. Which large molecule, then,
appeared first in getting life started--proteins (the chicken) or DNA
(the egg)?

A possible solution appeared when attention shifted to a new champion-
-RNA. This versatile class of molecule is, like DNA, assembled of
nucleotide building blocks, but plays many roles in our cells.
Certain RNAs ferry information from DNA to structures (which
themselves are largely built of other kinds of RNA) that construct
proteins. In carrying out its various duties, RNA can take on the
form of a double helix that resembles DNA, or of a folded single
strand, much like a protein. In 2006 the Nobel prizes in both
chemistry and medicine were awarded for discoveries concerning the
role of RNA in editing and censoring DNA instructions. Warren E.
Leary could write in the New York Times that RNA "is swiftly emerging
from the shadows of its better-known cousin DNA."

For many scientists in the origin-of-life field, those shadows had
lifted two decades earlier with the discovery of ribozymes, enzyme-
like substances made of RNA. A simple solution to the chicken-and- egg
riddle now appeared to fall into place: Life began with the
appearance of the first RNA molecule. In a germinal 1986 article,
Nobel Laureate Walter Gilbert of Harvard University wrote in the
journal Nature: "One can contemplate an RNA world, containing only
RNA molecules that serve to catalyze the synthesis of themselves. &
The first step of evolution proceeds then by RNA molecules performing
the catalytic activities necessary to assemble themselves from a
nucleotide soup." In this vision, the first self-replicating RNA that
emerged from non-living matter carried out the functions now executed
by RNA, DNA and proteins.

A number of additional clues seemed to support the idea that RNA
appeared before proteins and DNA in the evolution of life. Many small
molecules, called cofactors, play a necessary role in enzyme-
catalyzed reactions. These cofactors often carry an attached RNA
nucleotide with no obvious function. These structures have been
considered "molecular fossils," relics descended from the time when
RNA alone, without DNA or proteins, ruled the biochemical world. In
addition, chemists have been able to synthesize new ribozymes that
display a variety of enzyme-like activities. Many scientists found
the idea of an organism that relied on ribozymes, rather than protein
enzymes, very attractive.

The hypothesis that life began with RNA was presented as a likely
reality, rather than a speculation, in journals, textbooks and the
media. Yet the clues I have cited only support the weaker conclusion
that RNA preceded DNA and proteins; they provide no information about
the origin of life, which may have involved stages prior to the RNA
world in which other living entities ruled supreme. Just the same,
and despite the difficulties that I will discuss in the next section,
perhaps two-thirds of scientists publishing in the origin-of life
field (as judged by a count of papers published in 2006 in the
journal Origins of Life and Evolution of the Biosphere) still support
the idea that life began with the spontaneous formation of RNA or a
related self-copying molecule. Confusingly, researchers use the
term "RNA World" to refer to both the strong and the weak claims
about RNA's role prior to DNA and proteins. Here, I will use the
term "RNA first" for the strong claim that RNA was involved in the
origin of life.

The Soup Kettle is Empty

The attractive features of RNA World prompted Gerald Joyce of the
Scripps Research Institute and Leslie Orgel of the Salk Institute to
picture it as "the molecular biologist's dream" within a volume
devoted to that topic. They also used the term "the prebiotic
chemist's nightmare" to describe another part of the picture: How did
that first self-replicating RNA arise? Enormous obstacles block
Gilbert's picture of the origin of life, sufficient to provoke
another Nobelist, Christian De Duve of Rockefeller University, to ask
rhetorically, "Did God make RNA?"

RNA's building blocks, nucleotides, are complex substances as organic
molecules go. They each contain a sugar, a phosphate and one of four
nitrogen-containing bases as sub-subunits. Thus, each RNA nucleotide
contains 9 or 10 carbon atoms, numerous nitrogen and oxygen atoms and
the phosphate group, all connected in a precise three-dimensional
pattern. Many alternative ways exist for making those connections,
yielding thousands of plausible nucleotides that could readily join
in place of the standard ones but that are not represented in RNA.
That number is itself dwarfed by the hundreds of thousands to
millions of stable organic molecules of similar size that are not
nucleotides.

The RNA nucleotides are familiar to chemists because of their
abundance in life and their resulting commercial availability. In a
form of molecular vitalism, some scientists have presumed that nature
has an innate tendency to produce life's building blocks
preferentially, rather than the hordes of other molecules that can
also be derived from the rules of organic chemistry. This idea drew
inspiration from a well known experiment published in 1953 by Stanley
Miller. He applied a spark discharge to a mixture of simple gases
that were then thought to represent the atmosphere of the early
Earth. Two amino acids of the set of 20 used to construct proteins
were formed in significant quantities, with others from that set
present in small amounts. (A description of the Miller experiment and
the chemical structures of an amino acid and a nucleotide can be
found in "The Origin of Life on the Earth," by L. E. Orgel;
Scientific American, October 1994.) In addition, more than 80
different amino acids, some present and others absent from living
systems, have been identified as components of the Murchison
meteorite, which fell in Australia in 1969. Nature has apparently
been generous in providing a supply of these particular building
blocks. By extrapolation of these results, some writers have presumed
that all of life's building could be formed with ease in Miller-type
experiments and were present in meteorites and other extraterrestrial
bodies. This is not the case.

A careful examination of the results of the analysis of several
meteorites led the scientists who conducted the work to a different
conclusion: inanimate nature has a bias toward the formation of
molecules made of fewer rather than greater numbers of carbon atoms,
and thus shows no partiality in favor of creating the building blocks
of our kind of life. (When larger carbon-containing molecules are
produced, they tend to be insoluble, hydrogen-poor substances that
organic chemists call tars.) I have observed a similar pattern in the
results of many spark discharge experiments.

Amino acids, such as those produced or found in these experiments,
are far less complex than nucleotides. Their defining features are an
amino group (a nitrogen and two hydrogens) and a carboxylic acid
group (a carbon, two oxygens and a hydrogen) both attached to the
same carbon. The simplest of the 20 used to build natural proteins
contains only two carbon atoms. Seventeen of the set contain six or
fewer carbons. The amino acids and other substances that were
prominent in the Miller experiment contained two and three carbon
atoms. By contrast, no nucleotides of any kind have been reported as
products of spark discharge experiments or in studies of meteorites,
nor have the smaller units (nucleosides) that contain a sugar and
base but lack the phosphate.

To rescue the RNA-first concept from this otherwise lethal defect,
its advocates have created a discipline called prebiotic synthesis.
They have attempted to show that RNA and its components can be
prepared in their laboratories in a sequence of carefully controlled
reactions, normally carried out in water at temperatures observed on
Earth. Such a sequence would start usually with compounds of carbon
that had been produced in spark discharge experiments or found in
meteorites. The observation of a specific organic chemical in any
quantity (even as part of a complex mixture) in one of the above
sources would justify its classification as "prebiotic," a substance
that supposedly had been proved to be present on the early Earth.
Once awarded this distinction, the chemical could then be used in
pure form, in any quantity, in another prebiotic reaction. The
products of such a reaction would also be considered "prebiotic" and
employed in the next step in the sequence.

The use of reaction sequences of this type (without any reference to
the origin of life) has long been an honored practice in the
traditional field of synthetic organic chemistry. My own PhD thesis
advisor, Robert B. Woodward, was awarded the Nobel Prize for his
brilliant syntheses of quinine, cholesterol, chlorophyll and many
other substances. It mattered little if kilograms of starting
material were required to produce milligrams of product. The point
was the demonstration that humans could produce, however
inefficiently, substances found in nature. Unfortunately, neither
chemists nor laboratories were present on the early Earth to produce
RNA.

I will cite one example of prebiotic synthesis, published in 1995 by
Nature and featured in the New York Times. The RNA base cytosine was
prepared in high yield by heating two purified chemicals in a sealed
glass tube at 100 degrees Celsius for about a day. One of the
reagents, cyanoacetaldehyde, is a reactive substance capable of
combining with a number of common chemicals that may have been
present on the early Earth. These competitors were excluded. An
extremely high concentration was needed to coax the other
participant, urea, to react at a sufficient rate for the reaction to
succeed. The product, cytosine, can self-destruct by simple reaction
with water. When the urea concentration was lowered, or the reaction
allowed to continue too long, any cytosine that was produced was
subsequently destroyed. This destructive reaction had been discovered
in my laboratory, as part of my continuing research on environmental
damage to DNA. Our own cells deal with it by maintaining a suite of
enzymes that specialize in DNA repair.

The exceptionally high urea concentration was rationalized in the
Nature paper by invoking a vision of drying lagoons on the early
Earth. In a published rebuttal, I calculated that a large lagoon
would have to be evaporated to the size of a puddle, without loss of
its contents, to achieve that concentration. No such feature exists
on Earth today.

The drying lagoon claim is not unique. In a similar spirit, other
prebiotic chemists have invoked freezing glacial lakes, mountainside
freshwater ponds, flowing streams, beaches, dry deserts, volcanic
aquifers and the entire global ocean (frozen or warm as needed) to
support their requirement that the "nucleotide soup" necessary for
RNA synthesis would somehow have come into existence on the early
Earth.

The analogy that comes to mind is that of a golfer, who having played
a golf ball through an 18-hole course, then assumed that the ball
could also play itself around the course in his absence. He had
demonstrated the possibility of the event; it was only necessary to
presume that some combination of natural forces (earthquakes, winds,
tornadoes and floods, for example) could produce the same result,
given enough time. No physical law need be broken for spontaneous RNA
formation to happen, but the chances against it are so immense, that
the suggestion implies that the non-living world had an innate desire
to generate RNA. The majority of origin-of-life scientists who still
support the RNA-first theory either accept this concept (implicitly,
if not explicitly) or feel that the immensely unfavorable odds were
simply overcome by good luck.

A Simpler Replicator?

Many chemists, confronted with these difficulties, have fled the RNA-
first hypothesis as if it were a building on fire. One group,
however, still captured by the vision of the self-copying molecule,
has opted for an exit that leads to similar hazards. In these revised
theories, a simpler replicator arose first and governed life in
a "pre-RNA world." Variations have been proposed in which the bases,
the sugar or the entire backbone of RNA have been replaced by simpler
substances, more accessible to prebiotic syntheses. Presumably, this
first replicator would also have the catalytic capabilities of RNA.
Because no trace of this hypothetical primal replicator and catalyst
has been recognized so far in modern biology, RNA must have
completely taken over all of its functions at some point following
its emergence.

Further, the spontaneous appearance of any such replicator without
the assistance of a chemist faces implausibilities that dwarf those
involved in the preparation of a mere nucleotide soup. Let us presume
that a soup enriched in the building blocks of all of these proposed
replicators has somehow been assembled, under conditions that favor
their connection into chains. They would be accompanied by hordes of
defective building blocks, the inclusion of which would ruin the
ability of the chain to act as a replicator. The simplest flawed unit
would be a terminator, a component that had only one "arm" available
for connection, rather than the two needed to support further growth
of the chain.

There is no reason to presume than an indifferent nature would not
combine units at random, producing an immense variety of hybrid
short, terminated chains, rather than the much longer one of uniform
backbone geometry needed to support replicator and catalytic
functions. Probability calculations could be made, but I prefer a
variation on a much-used analogy. Picture a gorilla (very long arms
are needed) at an immense keyboard connected to a word processor. The
keyboard contains not only the symbols used in English and European
languages but also a huge excess drawn from every other known
language and all of the symbol sets stored in a typical computer. The
chances for the spontaneous assembly of a replicator in the pool I
described above can be compared to those of the gorilla composing, in
English, a coherent recipe for the preparation of chili con carne.
With similar considerations in mind Gerald F. Joyce of the Scripps
Research Institute and Leslie Orgel of the Salk Institute concluded
that the spontaneous appearance of RNA chains on the lifeless
Earth "would have been a near miracle." I would extend this
conclusion to all of the proposed RNA substitutes that I mentioned
above.

Life With Small Molecules

Nobel Laureate Christian de Duve has called for "a rejection of
improbabilities so incommensurably high that they can only be called
miracles, phenomena that fall outside the scope of scientific
inquiry." DNA, RNA, proteins and other elaborate large molecules must
then be set aside as participants in the origin of life. Inanimate
nature provides us with a variety of mixtures of small molecules,
whose behavior is governed by scientific laws, rather than by human
intervention.

Fortunately, an alternative group of theories that can employ these
materials has existed for decades. The theories employ a
thermodynamic rather than a genetic definition of life, under a
scheme put forth by Carl Sagan in the Encyclopedia Britannica: A
localized region which increases in order (decreases in entropy)
through cycles driven by an energy flow would be considered alive.
This small-molecule approach is rooted in the ideas of the Soviet
biologist Alexander Oparin, and current notable spokesmen include de
Duve, Freeman Dyson of the Institute for Advanced Study, Stuart
Kauffman of the Santa Fe Institute, Doron Lancet of the Weizmann
Institute, Harold Morowitz of George Mason University and the
independent researcher Gunter Wachtershauser. I estimate that about a
third of the chemists involved in the study of the origin of life
subscribe to theories based on this idea. Origin-of-life proposals of
this type differ in specific details; here I will try to list five
common requirements (and add some ideas of my own).

(1) A boundary is needed to separate life from non-life. Life is
distinguished by its great degree of organization, yet the second law
of thermodynamics requires that the universe move in a direction in
which disorder, or entropy, increases. A loophole, however, allows
entropy to decrease in a limited area, provided that a greater
increase occurs outside the area. When living cells grow and
multiply, they convert chemical energy or radiation to heat at the
same time. The released heat increases the entropy of the
environment, compensating for the decrease in living systems. The
boundary maintains this division of the world into pockets of life
and the nonliving environment in which they must sustain themselves.
Today, sophisticated double-layered cell membranes, made of chemicals
classified as lipids, separate living cells from their environment.
When life began, some natural feature probably served the same
purpose. David W. Deamer of the University of California, Santa Cruz,
has observed membrane-like structures in meteorites. Other proposals
have suggested natural boundaries not used by life today, such as
iron sulfide membranes, mineral surfaces (in which electrostatic
interactions segregate selected molecules from their environment) ,
small ponds and aerosols.

(2) An energy source is needed to drive the organization process. We
consume carbohydrates and fats, and combine them with oxygen that we
inhale, to keep ourselves alive. Microorganisms are more versatile,
and can use minerals in place of the food or the oxygen. In either
case, the transformations that are involved are called redox
reactions. They involve the transfer of electrons from an electron
rich (or reduced) substance to an electron poor (or oxidized) one.
Plants can capture solar energy directly, and adapt it for the
functions of life. Other forms of energy are used by cells in
specialized circumstances- -for example, differences in acidity on
opposite sides of a membrane. Yet others, such as radioactivity and
abrupt temperature differences, might be used by life elsewhere in
the universe. Here I will consider redox reactions as the energy
source.

(3) A coupling mechanism must link the release of energy to the
organization process that produces and sustains life. The release of
energy does not necessarily produce a useful result. Chemical energy
is released when gasoline is burned within the cylinders of my
automobile, but the vehicle will not move unless that energy is used
to turn the wheels. A mechanical connection, or coupling, is
required. Each day, in our own cells, each of us degrades pounds of a
nucleotide called ATP. The energy released by this favorable reaction
serves to drive processes that are less favorable but necessary for
our biochemistry. Linkage is achieved when the reactions share a
common intermediate, and the process is speeded up by the
intervention of an enzyme. One assumption of the small-molecule
approach is that coupled reactions and primitive catalysts sufficient
to get life started exist in nature.

(4) A chemical network must be formed, to permit adaptation and
evolution. We come now to the heart of the matter. Imagine for
example that an energetically favorable redox reaction of a naturally-
occurring mineral is linked to the conversion of an organic chemical
A to another one B within a compartment. The favorable, energy
releasing, entropy-increasing reaction of the mineral drives the A-to-
B transformation. I call this key transformation a driver reaction,
for it serves as the engine that mobilizes the organization process.
If B simply reconverts back to A or escapes from the compartment, we
would not be on a path that leads to increased organization. By
contrast, if a multi-step chemical pathway--say, B to C to D to A--
reconverts B to A, then the steps in that circular process (or cycle)
would be favored because they replenish the supply of A, allowing the
continuing discharge of energy by the mineral reaction.

If we visualize the cycle as a circular railway line, the energy
source keeps the trains traveling around it one way. Each station may
also be the hub for a number of branch lines, such as one connecting
station D to another station, E. Trains could travel in either
direction along that branch, depleting or augmenting the cycle's
traffic. Thanks to the continual depletion of A, however, material is
drawn from D to A. The resulting depletion of D in turn tends to draw
material from E to D. In this way, material is "pulled" along the
branch lines into the central cycle, maximizing the energy release
that accompanies the driver reaction.

The cycle could also adapt to changing circumstances. As a child, I
was fascinated by the way in which water, released from a leaky
hydrant, would find a path downhill to the nearest sewer. If falling
leaves or dropped refuse blocked that path, the water would back up
until another route was found around the obstacle. In the same way,
if a change in the acidity or in some other environmental
circumstance should hinder a step in the pathway from B to A,
material would back up until another route was found. Additional
changes of this type would convert the original cycle into a network.
This trial-and-error exploration of the chemical "landscape" might
also turn up compounds that could catalyze important steps in the
cycle, increasing the efficiency with which the network utilized the
energy source.

(5) The network must grow and reproduce. To survive and grow, the
network must gain material at a rate that compensates for the paths
that remove it. Diffusion of network materials out of the compartment
into the external world is favored by entropy and will occur to some
extent, especially at the start of life when the boundary is a crude
one established by the environment rather than one of the highly
effective cell membranes available today after billions of years of
evolution. Some side reactions may produce gases, which escape, or
form tars, which will drop out of solution. If these processes
together should exceed the rate at which the network gains material,
then it would be extinguished. Exhaustion of the external fuel would
have the same effect. We can imagine, on the early Earth, a situation
where many startups of this type occur, involving many alternative
driver reactions and external energy sources. Finally, a particularly
hardy one would take root and sustain itself.

A system of reproduction must eventually develop. If our network is
housed in a lipid membrane, then physical forces may split it, after
it has grown enough. (Freeman Dyson has described such a system as
a "garbage-bag world" in contrast to the "neat and beautiful scene"
of the RNA world.) A system that functions in a compartment within a
mineral may overflow into adjacent compartments. Whatever the
mechanism may be, this dispersal into separated units protects the
system from total extinction by a localized destructive event. Once
independent units were established, they could evolve in different
ways and compete with one another for raw materials; we would have
made the transition from life that emerges from nonliving matter
through the action of an available energy source to life that adapts
to its environment by Darwinian evolution.

Changing the Paradigm

Systems of the type I have described usually have been classified
under the heading "metabolism first," which implies that they do not
contain a mechanism for heredity. In other words, they contain no
obvious molecule or structure that allows the information stored in
them (their heredity) to be duplicated and passed on to their
descendants. However a collection of small items holds the same
information as a list that describes the items. For example, my wife
gives me a shopping list for the supermarket; the collection of
grocery items that I return with contains the same information as the
list. Doron Lancet has given the name "compositional genome" to
heredity stored in small molecules, rather than a list such as DNA or
RNA.

The small molecule approach to the origin of life makes several
demands upon nature (a compartment, an external energy supply, a
driver reaction coupled to that supply, and the existence of a
chemical network that contains that reaction). These requirements are
general in nature, however, and are immensely more probable than the
elaborate multi-step pathways needed to form a molecule that can
function as a replicator.

Over the years, many theoretical papers have advanced particular
metabolism first schemes, but relatively little experimental work has
been presented in support of them. In those cases where experiments
have been published, they have usually served to demonstrate the
plausibility of individual steps in a proposed cycle. The greatest
amount of new data has perhaps come from Gunter Wachtershauser and
his colleagues at the Technische Universitat Munchen. They have
demonstrated portions of a cycle involving the combination and
separation of amino acids, in the presence of metal sulfide
catalysts. The energetic driving force for the transformations is
supplied by the oxidation of carbon monoxide to carbon dioxide. They
have not yet demonstrated the operation of a complete cycle or its
ability to sustain itself and undergo further evolution. A "smoking
gun" experiment displaying those three features is needed to
establish the validity of the small molecule approach.

The principal initial task is the identification of candidate driver
reactions--small molecule transformations (A to B in the example
before) that are coupled to an abundant external energy source (such
as the oxidation of carbon monoxide or a mineral). Once a plausible
driver reaction has been identified, there should be no need to
specify the rest of the system in advance. The selected components
(including the energy source) plus a mixture of other small molecules
normally produced by natural processes (and likely to have been
abundant on the early Earth) could be combined in a suitable reaction
vessel. If an evolving network were established, we would expect the
concentration of the participants in the network to increase and
alter with time. New catalysts that increased the rate of key
reactions might appear, while irrelevant materials would decrease in
quantity. The reactor would need an input device to allow
replenishment of the energy supply and raw materials, and an outlet
to permit the removal of waste products and chemicals that were not
part of the network.

In such experiments, failures would be easily identified. The energy
might be dissipated without producing any significant changes in the
concentrations of the other chemicals or the chemicals might simply
be converted to a tar, which would clog the apparatus. A success
might demonstrate the initial steps on the road to life. These steps
need not duplicate those that took place on the early Earth. It is
more important that the general principle be demonstrated and made
available for further investigation. Many potential paths to life may
exist, with the choice dictated by the local environment.

An understanding of the initial steps leading to life would not
reveal the specific events that led to the familiar DNA-RNA-protein-
based organisms of today. However, because we know that evolution
does not anticipate future events, we can presume that nucleotides
first appeared in metabolism to serve some other purpose, perhaps as
catalysts or as containers for the storage of chemical energy (the
nucleotide ATP still serves this function today). Some chance event
or circumstance may have led to the connection of nucleotides to form
RNA. The most obvious function of RNA today is to serve as a
structural element that assists in the formation of bonds between
amino acids in the synthesis of proteins. The first RNAs may have
served the same purpose, but without any preference for specific
amino acids. Many further steps in evolution would be needed
to "invent" the elaborate mechanisms for replication and specific
protein synthesis that we observe in life today.

If the general small-molecule paradigm were confirmed, then our
expectations of the place of life in the universe would change. A
highly implausible start for life, as in the RNA-first scenario,
implies a universe in which we are alone. In the words of the late
Jacques Monod, "The universe was not pregnant with life nor the
biosphere with man. Our number came up in the Monte Carlo game." The
small-molecule alternative, however, is in harmony with the views of
biologist Stuart Kauffman: "If this is all true, life is vastly more
probable than we have supposed. Not only are we at home in the
universe, but we are far more likely to share it with unknown
companions."
==
Lenny Flank:
"Deception by Design: The Intelligent Design Movement in America"
==
"The picturesque Italian village of Limane Sul Garden,
seemingly untouched by the ravages of modern life,
holds a secret. About forty residents have lived to
be centenarians. "

The story goes on to say that about one in twenty
villagers have the advantage of a positive mutation
of the apoloprotein named A1. This mutation scavenges
cholesterol in the blood and escorts it to the liver
where it is broken down. "Hopes are high that this
mutated gene will provide a new and effective way
of treating coronary artery disease."

This is exactly the sort of mutation that evolution
through natural selection should bring into the human
genome so that it is a common characteristic of all
humans. I read on another web site that science had
used DNA studies along with family trees to identify
the actual person who had the original mutation.
That person lived some time around 1800. In the
village of Limane Sul Garden where the mutation
originally occurred, geneticists have found some
180 people who share that mutation. It is likely
that over two centuries, SOME people with that mutation
have left the village and their descendents are passing
on the mutation outside of the purview of science.
But nonetheless, I would think that an estimate of
500 individuals is at the high side of those with
this particular mutation.
==
http://evolution.berkeley.edu/ about evolution.
==
"Genesis: The Scientific Quest for Life's Origins" by Robert M. Hazen.
Hazen's book would give a very good overview of the current research into
abiogenesis.

http://www.theregister.co.uk/2005/08/17/harvard_origin_of_life/

"The Origin of Life" by Paul Davies
==
IMax cinemas in some of the southern states reportedly refused to show
several scientific films, after test audiences objected to the presentation of
evolutionary theory as fact, describing it instead as "blasphemous".
==
Jurassic Shrimp
Census of Marine Life researchers got a big surprise when they trawled up this
"Jurassic shrimp."
The scientists were documenting life on undersea mountains, or seamounts, in
the Coral Sea off northeast Australia when they found this specimen (Australia
map). It belongs to a species thought to have died out some 50 million years
ago.
Caught at a depth of 1,300 feet (400 meters), the new species is described as
a "living fossil" by survey member Bertrand Richer de Forges, a marine
biologist based in nearby Noumea, New Caledonia.
Neoglyphea neocaledonica belongs to an ancient group of crustaceans that were
"well known from the Jurassic and Cretaceous periods [roughly 200 to 65
million years ago] and were supposed to be extinct," de Forges said.
The find follows the discovery of a related species in Philippine waters in
the 1970s.
De Forges compares the new catch to the discovery of a second species of the
primitive coelacanth in Indonesia in 1997. This so-called fossil fish was
first rediscovered off South Africa in 1938, showing it hadn't gone extinct in
the Cretaceous period as previously thought.
==
Southern Australia throws up treasure trove of fossils
- Caves in the Sun-scorched, treeless wilderness of southern Australia's
Nullarbor plain have revealed one of the world's most remarkable collections
of fossils, including species of now-extinct kangaroos that lived hundreds of
thousands of years ago.
The three Thylacoleo caves, located about 100 kilometers (60 miles) from the
coast, were uncovered by potholers in 2002.
The find "is without precedent in Australia. Several new and previously
incompletely known species are represented by whole skeletons," enthuse a team
of researchers, reporting on the treasure trove in Thursday's issue of Nature.
The fossils date back to the Middle Pleistocene era, between 800,000 and
200,000 years ago.
They include 23 species of kangaroo, eight of which had never been identified
before. Two of the species were tree kangaroos which had adapted to living in
branches.
Other animals were several species of wallaby, a range of lizards including a
large species called the King's skink (Egernia kingii), a carnivorous
marsupial called the mulgara, which was related to the endangered Tasmanian
devil, and two parrots.
Most of the creatures fell to their deaths from the surface, tumbling down
pipe-like openings into the cave, whose floor was 20 metres (64 feet) below.
Of the 69 vertebrate species found in the caves, 21 did not make it through
the Pleistocene, an era that spanned 1.8 million to 11,550 years ago and led
to the Holocene, as today's post-Ice Age period is called.
One theory for large extinctions in southern Australia was that at one point
the Pleistocene climate became warmer and drier, catastrophically changing the
vegetation on which many herbivores (and thus their prey) depended.
But the researchers, led by Gavin Prideaux of the Western Australian Museum in
Perth, say the die-out cannot be explained by this alone.
They point to the presence of the lizards, which love hot, dry climates, and
to species which survived elsewhere in Australia beyond the Pleistocene and
were resilient to warming.
What may have done for the species was a surge of wildfires in the Nullarbor,
they suggest.
The diverse vegetation that had harboured so many species was swept away,
replaced by the small, fire-resistant chenopod shrub that studs the plain
today.
And Man helped sound the death knell: "Most southern species of mega-fauna
were evidently extinct by or soon after 40,000 years ago, at about the time
humans reached the south-central coast."
==
http://www.eurekalert.org/pub_releases/2007-01/yu-pdm012307.php
Paleontologists discover most primitive primate skeleton
The origins and earliest branches of primate evolution are clearer and more
ancient by 10 million years than previous studies estimated, according to a
study featured on the cover of the Jan. 23 print edition of the Proceedings of
the National Academy of Sciences.
The paper by researchers at Yale, the University of Winnipeg, Stony Brook
University, and led by University of Florida paleontologist Jonathan Bloch
reconstructs the base of the primate family tree by comparing skeletal and
fossil specimens representing more than 85 modern and extinct species. The
team also discovered two 56-million-year-old fossils, including the most
primitive primate skeleton ever described.
In the two-part study, an extensive evaluation of skeletal structures provides
evidence that plesiadapiforms, a group of archaic mammals once thought to be
more closely related to flying lemurs, are the most primitive primates. The
team analyzed 173 characteristics of modern primates, tree shrews, flying
lemurs with plesiadapiform skeletons to determine their evolutionary
relationships. High-resolution CT scanning made fine resolution of
inaccessible structures inside the skulls possible.
"This is the first study to bring it all together," said co-author Eric
Sargis, associate professor of anthropology at Yale University and Assistant
Curator of Vertebrate Zoology at Yale's Peabody Museum of Natural History.
"The extensive dataset, the number and type of characteristics we were able to
compare, and the availability of full skeletons, let us test far more than any
previous study."
At least five major features characterize modern primates: relatively large
brains, enhanced vision and eyes that face forward, a specialized ability to
leap, nails instead of claws on at least the first toes, and specialized
grasping hands and feet. Plesiadapiforms have some but not all of these
traits. The article argues that these early primates may have acquired the
traits over 10 million years in incremental changes to exploit their
environment.
While the study did not include a molecular evaluation of the samples,
according to Sargis, these results are consistent with molecular studies on
related living groups. Compatibility with the independent molecular data
increases the researchers' confidence in their own results.
Bloch discovered the new plesiadapiform species, Ignacius clarkforkensis and
Dryomomys szalayi, just outside Yellowstone National Park in the Bighorn Basin
with co-author Doug Boyer, a graduate student in anatomical sciences at Stony
Brook. Previously, based only on skulls and isolated bones, scientists
proposed that Ignacius was not an archaic primate, but instead a gliding
mammal related to flying lemurs. However, analysis of a more complete and
well-preserved skeleton by Bloch and his team altered this idea.
"These fossil finds from Wyoming show that our earliest primate ancestors were
the size of a mouse, ate fruit and lived in the trees," said study leader
Jonathan Bloch, a vertebrate paleontology curator at the Florida Museum of
Natural History. "It is remarkable to think we are still discovering new
fossil species in an area studied by paleontologists for over 100 years."
Researchers previously hypothesized plesiadapiforms as the ancestors of modern
primates, but the idea generated strong debate within the primatology
community. This study places the origins of Plesiadapiforms in the Paleocene,
about 65 (million) to 55 million years ago in the period between the
extinction of the dinosaurs and the first appearance of a number of undisputed
members of the modern orders of mammals.
"Plesiadapiforms have long been one of the most controversial groups in
mammalian phylogeny," said Michael J. Novacek, curator of paleontology at the
American Museum of Natural History. "First, they are somewhere near primates
and us. Second, historically they have offered tantalizing, but very often
incomplete, fossil evidence. But the specimens in their study are beautifully
and spectacularly preserved."
"The results of this study suggest that plesiadapiforms are the critical taxa
to study in understanding the earliest phases of human evolution. As such,
they should be of very broad interest to biologists, paleontologists, and
anthropologists," said co-author Mary Silcox, professor of anthropology at the
University of Winnipeg.
"This collaboration is the first to bring together evidence from all regions
of the skeleton, and offers a well-supported perspective on the structure of
the earliest part of the primate family tree," Bloch said.
The research was supported by grants from the National Science Foundation,
Field Museum of Natural History, Yale University, Sigma Xi Scientific Research
Society, Natural Sciences and Engineering Research Council (Canada), University
of Winnipeg, the Paleobiological Fund, and The WennerGren Foundation for
Anthropological Research.
==
If the third base of the TCT codon for serine is changed to any of the other
three bases, serine will still be the result.
==
http://www.darkboards.com/articles/science/evolution/newspecies.php
==
Mice can have up to 10 litters per year with up to
8 pups per litter. That's up to 80 pups each year, every year- and
the young become sexually mature and start having their own litters
in as little as sex weeks after birth. That's hardly a very strong
r-strategist- if that's what you were saying. Whales are a good
example of r-strategists.
Second, with the mutation think- you seem to have this impression
that mutations are these rare events which populations must sit
around waiting for. Here is part of an abstract from a paper where
they actually empirically measured the mutation rate in humans- and
remember, we're rather extreme r-strategists.
"Many previous estimates of the mutation rate in humans have relied
on screens of visible mutants. We investigated the rate and pattern
of mutations at the nucleotide level by comparing pseudogenes in
humans and chimpanzees to (i) provide an estimate of the average
mutation rate per nucleotide, (ii) assess heterogeneity of mutation
rate at different sites and for different types of mutations, (iii)
test the hypothesis that the X chromosome has a lower mutation rate
than autosomes, and (iv) estimate the deleterious mutation rate.
Eighteen processed pseudogenes were sequenced, including 12 on
autosomes and 6 on the X chromosome. The average mutation rate was
estimated to be 2.5 x 10-8 mutations per nucleotide site or 175
mutations per diploid genome per generation. "
Genetics, Vol. 156, 297-304, September 2000
Estimate of the Mutation Rate per Nucleotide in Humans
Michael W. Nachmana and Susan L. Crowella
Department of Ecology and Evolutionary Biology, University of
Arizona, Tucson, Arizona 85721
OK, so bottom line is an average of 175 mutations PER GENOME. That
means per person. Every person. Every generation. And since these
are measured from live people walking around in the world today, this
estimate excludes lethals. Think on that.
So, we have a current population of over 6 billion. Say there are
about three generations alive at any one time (very roughly), that
means that there are about 2 billion in each current population.
That means 2 billion genomes in each human generation walking around
today. 175 times 2 billion gives 350 billion mutations at any one
time. With a genome size of only 3 billion base pairs, and only some
30,000 genes, it seems to me that waiting for a mutation to crop up
at some particular spot in some particular gene would not likely be
that long a wait.
And naturally it would go much, much faster with k-strategists, many
of which also have even higher mutation rates than humans.
==
By David P. Barash, DAVID P. BARASH is a professor of psychology at the
University of Washington.
GENETICISTS studying human and chimpanzee DNA have concluded that a few
million years ago, pre-humans and pre-chimps produced hybrids between
the two species. And in the American evolutionary wars, this is good news.
Of course, the very idea of ancestral human beings and chimpanzees
"exchanging genes" makes people squirm, because (let's face it) this
means sexual intercourse between our ancient human and animal ancestors.
It is hard enough to contemplate our parents copulating; to think of our
very great-grandparents not only descended from "monkeys" but having sex
with them is difficult to conceive. But conceive is what they evidently did.
There is, however, an even greater source of discomfort at work here;
not simple squeamishness about sex but a deeper repugnance that goes to
the heart of why so many Americans continue to be so resistant to the
theory of evolution. And this is why I not only welcome the news that
humans and chimpanzees commingled genes in the past, I also look forward
to the possibility that, thanks to advances in reproductive technology,
there will be hybrids, or some other mixed human-animal genetic
composite, in our future.
This may seem perverse, because even the most liberal ethicists shy away
from advocating the breeding or genetic engineering of
half-person/ half-animal. Why, then, am I rooting for their creation?
Because in these dark days of know-nothing anti-evolutionism, with
religious fundamentalists occupying the White House, controlling
Congress and attempting to distort the teaching of science in our
schools, a powerful dose of biological reality would be healthy indeed.
And this is precisely the message that chimeras, hybrids or
mixed-species clones would drive home.
The latest tactic of creationists in the United States has been to
accept "microevolutionary" events, such as drug resistance in bacteria,
but to draw the line at the emergence of human beings from other,
"lower" life forms, cloaking their religious agenda in a miasma of
pseudoscience. It is a line that exists only in the minds of those who
proclaim that the human species, unlike all others, possesses a spark of
the divine and that we therefore stand outside nature.
Should geneticists and developmental biologists succeed once again in
joining human and nonhuman animals in a viable organism --- as our
ancient human and chimp ancestors appear to have done long ago --- it
would be difficult and perhaps impossible for the special pleaders to
maintain the fallacy that Homo sapiens is uniquely disconnected from the
rest of life.
It is one thing to ignore the fact that we share roughly 98% of our
genotype with chimpanzees; but such "ignore-ance" would require even
more intellectual sleight-of-hand when human and nonhuman cells are
literally conjoined.
Moreover, the benefits of such a physical demonstration of
human-nonhuman unity would go beyond simply discomfiting the naysayers,
beyond merely bolstering a "reality based" as opposed to a bogus "faith
based" worldview. I am thinking of the powerful payoff that would come
from puncturing the most hurtful myth of all time, that of discontinuity
between human beings and other life forms. This myth is at the root of
our environmental destruction --- and our possible self-destruction.
Four decades ago, historian Lynn White wrote a now-classic article in
the journal Science making the point that much of the damaging
disconnect derives from the Judeo-Christian proclamation of radical
discontinuity between people and the rest of "creation." White argued
that the Western world took its marching orders from a literal reading
of Genesis: not only to go forth and multiply but also to dominate and,
whenever inclined, to destroy the animate world, which, lacking our
unique spiritual essence, existed only for human use and abuse. Whereas
"we" are special, chips off the old divine block, "they" (all other life
forms) are wholly different, made merely of matter. Hence, they don't
really matter.
==
A team of researchers from Panama, Colombia and the UK managed to
recreate /Heliconius heurippa /in the laboratory by crossing two other
species of butterfly; /Heliconius cydno /and /Heliconius melpomene /.
"The fact we've recreated this species in the lab provides a pretty
convincing route by which the natural species came about," co-author
Chris Jiggins, of the University of Edinburgh, told BBC News.
Jesus Mavarez, another author from the Smithsonian Tropical Research
Institute in Panama, explained: "We found that a wing pattern almost
identical to that of the hybrid can be obtained in months - just three
generations of lab crosses between /H. cydno /and /H. melpomene /.
*Wing patterns *
"Moreover, natural hybrids from San Cristobal, Venezuela, show wing
patterns very similar to /H. heurippa /, further supporting the idea of
a hybrid origin for this species."
In addition, there is growing circumstantial evidence for hybrid
speciation in /Ragoletis /fruit flies, swordtail fish and African
cichlid fish.
Some also suspect the American red wolf could be the product of
hybridisation between coyotes and wolves.
Colour patterns on the wings of the butterflies may be crucial in
forming new species, because they serve as mating cues. These
butterflies are extremely choosey about finding mates with their own,
species-specific wing pattern.
The wing patterns of /H. heurippa /individuals make them undesirable as
mates for members of their parent species, but attractive to each other
- reinforcing patterns of mating that lead to a new species.
These species-specific patterns are also crucial in deterring predators.
The butterflies produce toxins when eaten and predators learn to
recognise and avoid a specific wing pattern.
This is so finely tuned that butterflies with even slight deviations in
colour pattern suffer from higher predation.
==
When Toba volcano in western Sumatra erupted 73,000 +/- 4000 years ago it was
(and still is) the largest volcanic cataclysm to have taken place on planet
earth for the last 28 million years.
The eruption happened at a crucial time in the development of anatomically
modern humans. We will explore how, whether and to what extent the Toba
eruption and its climatic aftermath has influenced the development and spread
of modern Homo sapiens.
Therefore, the last Toba eruption (also called the YTT event for "Younger Toba
Tuff", is of enormous scientific and general interest.
==
Atmospheric concentrations of carbon dioxide in the Early Carboniferous
Period were approximately 1500 ppm, but by the Middle Carboniferous had
declined to about 350 ppm - comparable to average CO2 concentrations today.
Earth's atmosphere today contains about 380 ppm CO2 (0.038%). Compared to
former geologic times, our present atmosphere, like the Late Carboniferous
atmosphere, is CO2- impoverished. In the last 600 million years of Earth's
history only the Carboniferous Period and our present age, the Quaternary
Period, have witnessed CO2 levels less than 400 ppm. So the issue, as I see
it, is likely one of figuring out the relative change in CO2 concentrations
over time, since it has apparently fluxiated quite a bit over time. We know
what the concrentration is now, and what the current pressure is, as well
as what it was in the early carboniferous period. It stands to reason that
we should be able to figure out what those concentrations were during the
mesozoic (if that already hasn't been done), and thereby estimate what the
atmospheric pressure was (accounting for changes in other gas
concentrations as well, naturally). I'm not an expert in this particular
field either, but it seems like this would be a good place to start.
Doing a web search, I find that Berners' "results show a similar overall
pattern to those for GEOCARB II: very high CO2 values during the early
Paleozoic, a large drop during the Devonian and Carbonifer- ous, high
values during the early Mesozoic, and a gradual decrease from about 170 Ma
to low values during the Cenozoic. However, the new results exhibit
considerably higher CO2 values during the Mesozoic, and their downward
trend with time agrees with the independent estimates of Ekart and others
(1999).
So if the atmospheric pressure was high, the elevated CO2 levels may be
part of the reason. The questions in my mind are was the pressure high
enough to account for large land animals? Why would higher pressure
facilitate larger animals as opposed to an increase in oxygen levels?
Berner, for instance showed that O2 was higher during the Mesozoic (when
these big animals were evolving) than now
==
The oldest diverse Cambrian fauna are around 530-520 million years old, e.g.
the Chengjiang, in China.
==
http://www.bsu.edu/web/00cyfisher/ bird evolution *

There are currently greater than 9600 species of birds
in approximately 29 orders, 187 families, and 2000 genera.
Reconstructing the evolution of the Aves is a challenging
and ever changing process, as the geological record
for the history of birds is brief when compared
with other organisms.
==
1. Light-sensitive spots
2. Light-sensitive cups
3. Light-sensitive cups with pinhole openings
4. Light-sensitive cups with an adjustable opening (iris)
5. Light-sensitive cups with an iris and transparent covering (lens)
6. Fully complex eyes

Note that each of these provides improved fitness
over the previous characteristic.
==
Scientists find it significant that with tens of millions of fossils
collected and dated, not one is out of place from an evolutionary standpoint.
Those appearances and disappearances, the ones evolutionists are supposed to
find disconcerting, occur in precisely the patterns suggested by other methods
of reconstructing natural history. Zooming in a bit closer we find numerous
transitional forms, all of them at just the right place in geological history
and at just the right locations around the globe, documenting many of the
major transitions that are said to have occurred. At times there are so many
transitional forms, as with the evolution of mammals from reptiles, that it is
impossible to tell where one ends and the other begins.
==
Hen's Teeth and Horse's Toes (Paperback) by Stephen Jay Gould
==
"The Ghost Map" by Steven Johnson bacteria
==
One example of speciation is described on page 22 of the February, 1989
issue of Scientific American in an article titled "A Breed Apart." It tells
about studies conducted on a fruit fly, Rhagoletis pomonella, that is
a parasite of the hawthorn tree and its fruit, which is commonly called the
thorn apple. About 150 years ago, some of these flies began infesting apple
trees, as well. The flies feed and breed on either apples or thorn apples, but
not both. The scientific investigators found the flies now to be different
species.
==
The fossil bones of what may have been Europe's largest animal
ever, a new type of dinosaur, have been discovered in Spain.
Discovery of the sauropod, estimated to have weighed between 40 and 48 tons,
is reported in Friday's issue of the journal Science.
Named Turiasaurus riodevensis, the animal lived in the Teruel area of what is
now Spain in the late Jurassic period, about 150 million years ago.
The remains were found by a team led by Rafael Royo-Torres of the Joint
Paleontology Foundation Teruel-Dinopolis.
In the past such large dinosaurs have primarily been found in Africa and the
New World.
"The humerus the long bone in the foreleg that runs from the shoulder to the
elbow was as large as an adult" human, Brooks Hanson, a Science deputy
editor, said in a statement. The claw of the first digit of its pes, or hoof,
is the size of an NFL football.
The researchers found several other bones as well and were able to group the
new find with other remains from Portugal, France and Britain into a new
clade, or branch, of dinosaurs that has more-primitive limb and bone
structures than other giants.
===
There are about 2.9 billion base-pairs in the human genome wound into 24
distinct bundles, or chromosomes.
Written in the DNA are about 20-25,000 genes which human cells use as
starting templates to make proteins;
==
http://afarensis.blogsome.com/ evolution urls
===
Parthenogenesis is a process in which eggs become embryos without male
fertilization. It has been seen in about 70 species, including snakes and
lizards.
===
The Top 10 Myths About Evolution (Paperback)by Cameron Smith, Charles Sullivan
======
There are 16,097 scientific papers that discuss how blood evolved?
==
(The river that flows through the Neandertal is the Dussel, to which
Dusseldorf owes its name. The Neandertal was named after Joachim Neander.
==
The whale evolved from Diacodexis, to Pakicetus, to Ambulocetus, to
Dorudon, and finally to Balaena also known as Right Whales.
==
In Australopithecus afarensis, the group that includes the famous 3.2
million-year-old Lucy, males were about twice the size of females but their
canines had shrunk. By the time our more humanlike ancestor Homo erectus
migrated out of Africa around 2 million years ago, the size gap was more like
today's.
This may have happened because human babies needed more early care, so males
with fathering instincts beat out those with more brutish attributes.
But in many other species, it's the female who's the big one. In fact, the
Guinness Book of World Records has just included an entry for biggest
male-female difference: the deep-sea angler fish, also known as the giant sea
devil. It was named before any one saw a male. Females can stretch to around
five feet long but the males are about the size of flies.
The female is about 500,000 times heavier than the male, says Ted Pietsch of
the University of Washington, who's spent years studying these deep-sea
dwellers.
"The males are parasitic," says Pietsch. When a male anglerfish finds a mate,
he bites her, digs in, attaches himself permanently and starts living off her
blood.
==
Meteorite may hold secret to life outside earth
A meteoritethat crashed innorthwest Canadaalmost seven years ago might have
been able to host the very earliest life forms, according to NASA
researchers,which opensthe door to the possibility that life could be present
elsewhere in the universe.
Mike Zolensky, a cosmic minerologist at the NASA Space Centre in Texas, told
CBC Radio the Tagish Lake meteorite is unlike any they have ever examined.
Jim Brook found a piece of a meteorite in 2000 which NASA scientists say
contains tiny bubbles that may have been able to hold early forms of life.
(Adrian Wyld/Canadian Press)
"We always knew it was a rare, very carbon- and water-rich meteorite and they
hardly ever fall on the Earth," said Zolensky. "But we've found since that it's
even more unique than that. It's a totally unique meteorite."
Zolensky said tiny bubbles in the rock are organic globules where the
universe'searliest life forms could have been able to live, an astonishing
discovery from a meteoritethought to be4.5 billion years old older than the
Earth.
"Perhaps these are like little condos arriving on earth and biology can move
in later on," said Zolensky.
"They've survived somehow, intact on an asteroid for over four and a half
billion years and where they come from, we don't know. But it's not from
around here. It's from somewhere else."
Scientists have speculated life on earth began somewhere between 3.5and 3.9
billion years ago.
The meteor first attracted attention when a dramatic fireball lit up the early
morning skies of the Yukon, northern British Columbia, parts of Alaska, and the
Northwest Territorieson Jan. 18, 2000.
Fragments of the meteorite scattered across the Southern Lakes region of the
Yukon. A week later, outdoorsman Jim Brook discovered a remnant on Tagish Lake
between Atlin, B.C., and Carcross, Yukon.
Brook stored the meteorite in a freezer to keep it intact, a move that helped
give researchers a chance to study it before it could be influenced by the
environment on earth.
"This meteorite is unique because it was recovered frozen and some of these
samples came to us still frozen," said Zolensky. "It's never happened before,
may never happen again, and will always be a bonanza to science for that
reason."

Hollow spheres found in a primordial meteorite could yield clues to the origin
of life on Earth.
Scientists say that "bubbles" like those in the Tagish Lake meteorite may have
helped along chemical processes important for the emergence of life.
The globules could also be older than our Solar System - their chemistry
suggests they formed at about -260C, near "absolute zero".
Details of the work by Nasa scientists are published in the journal Science.
Analysis of the bubbles shows they arrived on Earth in the meteorite and are
not terrestrial contaminants.
These hollow spheres could have provided a protective envelope for the raw
organic molecules needed for life.
Dr Lindsay Keller of Nasa's Johnson Space Center (JSC) in Houston, Texas, told
BBC News that some scientists believed such structures were "a step in the
right direction" to making a cell wall.
But he emphasised that the globules in Tagish Lake were in no way equivalent
to a cell. The hollow spheres seem to be empty, but they do have organic
molecules on their surfaces.
Mike Zolensky, a Nasa mineralogist, commented: "If, as we suspect, this type
of meteorite has been falling on to Earth throughout its entire history, then
the Earth was seeded with these organic globules at the same time life was
first forming here."
Co-author Keiko Nakamura-Messenger of JSC told BBC News: "We reported only 26
globules in this paper, because they are small and hard to analyse. But we
have seen hundreds in a small area. We can estimate that there are billions of
them in this meteorite."
The ratios of different forms, or isotopes, of the elements hydrogen and
nitrogen in the meteorite are very unusual, which suggests the structures did
not come from Earth, say the scientists.
"The isotopic ratios in these globules show that they formed at temperatures
of about -260C, near absolute zero," said co-author Scott Messenger, also from
Johnson Space Center.
"The organic molecules most likely originated in the cold molecular cloud that
gave birth to our Solar System, or at the outermost reaches of the early Solar
System."
The Tagish Lake meteorite was collected immediately after its fall over Canada
in 2000. It has been maintained in a frozen state, minimising the potential for
terrestrial contamination.
==
During the Devonian period, the small tribe of fish known as rhipidistians
became the ancestors of 4 legged animals.
==
There's an old paradigm in human population genetics that we each differ from
each other by less than one percent at the DNA sequence level. While that may
be true for our DNA sequences, recent work indicates that there's also quite a
bit of variation amongst individuals in the actual content of their genomes.
Such variation is known as copy number variation (CNV) or copy number
polymorphism (CNP). What it means is that some people may have one copy of a
genomic region, other may have two, and even others may have none.
An article in Nature by Redon et al (a collaboration between Stephen Scherer's
group and Matthew Hurles's group) reporting a map of CNV in human populations
based on 270 individuals. The found 1,447 regions that varied in copy number
(CNVRs) which make up 360 megabases or 12% of the human genome. Many of these
regions contain functional genes, which has implications for evolution and
disease.
Not to be left out, Nature Genetics will be publishing an article that
compares the two human genome project sequences (that of Celera and the one
from the public project). The comparisons are used to identify structural
differences between the two sequences, such as CNVs, inversions, insertions,
and deletions.
While DNA sequence differences or single nucleotide polymorphisms (SNPs) may
explain some of the variation within populations and differences between them,
structural variations are responsible for a great deal of the phenotypic
polymorphism in human populations. And while some reports are selling this
research as revolutionary and groundbreaking (the one I linked to isn't that
bad), keep in mind what Susumo Ohno wrote in 1970:
Had evolution been entirely dependent on natural selection, from a bacterium
only numerous forms of bacteria would have emerged. The creation of metazoans,
vertebrates and finally mammals from unicellular organisms would have been
quite impossible, for such big leaps in evolution required the creation of new
gene loci with previous nonexistent functions.
Any good evolutionary biologist realizes that all differences between taxa
were, at some point, polymorphism within populations. The reason these recent
papers are important is not because they shift paradigms, but because they
represent technological achievements. It's because of our new-found sequencing
and computing powers, along with dedicated lab work, that we can study this
important feature of genome evolution at a population genetic level.
But these catalogues of structural polymorphisms are only the first step in
understanding the how CNV affects evolution. Many more projects need to be
completed to determine the phenotypic affects important CNPs (such as effects
of a polymorphic inversion on fecundity). Some of these may represent disease
loci. Others will play a role in differences between individuals. And some may
even explain differences between human populations.
==
Unraveling Where Chimp And Human Brains Diverge
Six million years ago, chimpanzees and humans diverged from a common ancestor
and evolved into unique species. Now UCLA scientists have identified a new way
to pinpoint the genes that separate us from our closest living relative -- and
make us uniquely human. The Proceedings of the National Academy of Sciences
reports the study in its Nov. 13 online edition.
"We share more than 95 percent of our genetic blueprint with chimps,"
explained Dr. Daniel Geschwind, principal investigator and Gordon and Virginia
MacDonald Distinguished Professor of Human Genetics at the David Geffen School
of Medicine. "What sets us apart from chimps are our brains: homo sapiens
means 'the knowing man.'
"During evolution, changes in some genes altered how the human brain
functions," he added. "Our research has identified an entirely new way to
identify those genes in the small portion of our DNA that differs from the
chimpanzee's. "
By evaluating the correlated activity of thousands of genes, the UCLA team
identified not just individual genes, but entire networks of interconnected
genes whose _expression patterns within the brains of humans varied from those
in the chimpanzee.
"Genes don't operate in isolation -- each functions within a system of related
genes," said first author Michael Oldham, UCLA genetics researcher. "If we
examined each gene individually, it would be similar to reading every fifth
word in a paragraph -- you don't get to see how each word relates to the
other. So instead we used a systems biology approach to study each gene within
its context."
The scientists identified networks of genes that correspond to specific brain
regions. When they compared these networks between humans and chimps, they
found that the gene networks differed the most widely in the cerebral cortex
-- the brain's most highly evolved region, which is three times larger in
humans than chimps.
Secondly, the researchers discovered that many of the genes that play a
central role in cerebral cortex networks in humans, but not in the chimpanzee,
also show significant changes at the DNA level.
"When we see alterations in a gene network that correspond to functional
changes in the genome, it implies that these differences are very meaningful,"
said Oldham. "This finding supports the theory that variations in the DNA
sequence contributed to human evolution."
Relying on a new analytical approach developed by corresponding author Steve
Horvath, UCLA associate professor of human genetics and biostatistics, the
UCLA team used data from DNA microarrays -- vast collections of tiny DNA spots
-- to map the activity of virtually every gene in the genome simultaneously. By
comparing gene activity in different areas of the brain, the team identified
gene networks that correlated to specific brain regions. Then they compared
the strength of these correlations between humans and chimps.
Many of the human-specific gene networks identified by the scientists related
to learning, brain cell activity and energy metabolism.
"If you view the brain as the body's engine, our findings suggest that the
human brain fires like a 12-cylinder engine, while the chimp brain works more
like a 6-cylinder engine," explained Geschwind. "It's possible that our genes
adapted to allow our brains to increase in size, operate at different speeds,
metabolize energy faster and enhance connections between brain cells across
different brain regions."
Future UCLA studies will focus on linking the _expression of evolutionary
genes to specific regions of the brain, such as those that regulate language,
speech and other uniquely human abilities.
==
Neanderthal DNA secrets unlocked

A genetic breakthrough could help clear up some long-standing mysteries
surrounding our closest evolutionary relatives: the Neanderthals.
Scientists have reconstructed a chunk of DNA from the genome of a Neanderthal
man who lived 38,000 years ago.
The genetic information they extracted from a thigh bone has allowed them to
identify more than a million building blocks of Neanderthal DNA so far.
Details of the efforts appear in the journals Nature and Science.
"The sequence data will serve as a DNA time machine," said co-author Edward
Rubin, from the Joint Genome Institute in Walnut Creek , California , US .
Research will now extend to complete the whole genome of a Neanderthal
"[It] will tell us about aspects of Neanderthal biology that we can never get
from their bones and associated artefacts."
Studying the Neanderthal genome will shed light on the genetic changes that
made our species what it is, after the evolutionary lineages of Neanderthals
and modern humans diverged from one another.
It could also reveal what colour hair, eyes and skin Neanderthals had, whether
they were capable of modern speech, shed light on aspects of their brain
function and determine whether they contributed to the modern human gene pool.
'Technical triumph'
Researchers have already sequenced mitochondrial DNA (mtDNA) from 12
Neanderthals. This is DNA from the cell's powerhouses, and which is passed
down from mother to child.
While mtDNA has confirmed that Neanderthals were indeed different from us,
the information gleaned from it is limited.
To answer more detailed questions about our evolutionary cousins, scientists
had to extract DNA that came from the cell's nucleus. This nuclear DNA encodes
most of an organism's genetic blueprint.
Researchers used cutting-edge DNA sequencing techniques to retrieve genetic
material from the Neanderthal femur found in the Vindija Cave, Croatia.
Writing in Nature journal, Professor Svante Paabo and colleagues describe how
they recovered more than one million base-pairs - the building blocks of DNA -
by directly reading the genetic sequence.
In another paper published in Science magazine, Professor Rubin's team used a
different approach called metagenomics, in which the fragments of genetic
material were incorporated into bacteria. These then copied themselves,
generating a living "library" of DNA sequences.
This method resulted in the recovery of 65,250 base-pairs of Neanderthal DNA.
While direct sequencing allows scientists to recover more genetic material, it
is a random process. The metagenomic approach should allow scientists to call
up specific genetic sequences of interest from the DNA library in a targeted
manner.
Language question
Professor Paabo told BBC science correspondent Pallab Ghosh that he planned to
look at the form of the gene FOXP2 in Neanderthals; this gene is implicated in
the development of language skills and has undergone evolution in modern
humans since our divergence from chimpanzees.
"We have two little snippets of genes involved in skin and hair colour, but
they don't give any hint of a special variant that would be of interest,"
Paabo told the BBC News website.
The two teams basically agree, within their margins of error, that the
evolutionary lineages of Neanderthals and modern humans split somewhere around
500,000 years ago. This fits with previous estimates from mtDNA and
archaeological data.
Professor Paabo, from the Max Planck Institute for Evolutionary Anthropology
in Leipzig , Germany , and his team also show that Neanderthals came from a
very small ancestral population of about 3,000 individuals.
At their peak, Neanderthals dominated a wide range - stretching from Britain
and Iberia in the west, to Israel in the south and Uzbekistan in the east.
This stocky, muscular human species was our closest evolutionary relative.
Modern humans entered Europe about 40,000 years ago; and within 10,000 years,
the Neanderthals had largely disappeared from the continent. By 24,000 years
ago, the last survivors had vanished from their refuge in the Iberian
Peninsula .
Extinct relative
The question of whether modern humans and Neanderthals mated when they
encountered each other 40,000 years ago is highly controversial.
One US scientist recently suggested modern humans might have acquired a
variant of the brain gene microcephalin through interbreeding with
Neanderthals.
Edward Rubin's team found no evidence for a Neanderthal contribution to the
modern gene pool, but Professor Paabo's analysis hints at a possible
contribution in the other direction - from modern humans into Neanderthals.
The researchers say more extensive sequencing is needed to address this
possibility.
Professor Chris Stringer, from London 's Natural History Museum, said the
results "confirm the distinctiveness of the Neanderthals, and support previous
estimates of the divergence time.
"Research will now extend to complete the whole genome of a Neanderthal and to
examine Neanderthal variation through time and space to compare with ours."
The researchers aim to produce a rough draft of the full Neanderthal genome
sequence over the next two years.
==
Below homo was hominini,then homininae, then hominidae, then hominoidea.
==
Origin of life: the search for the first genetic material
How did life originate on Earth? Until now, there have only been theories to
answer this question. One of the fundamental steps leading to living organisms
is the development of molecules that can replicate and multiply themselvesthe
first genetic material. A team led by Ramanarayanan Krishnamurthy and Albert
Eschenmoser at The Scripps Research Institute in La Jolla, California, is
researching how this molecule might have looked.
Our own genetic material is DNA. Its backbone is made of sugar and phosphate
building blocks. Like a strand of pearls, the four letters of the genetic code
are arranged along this backbone. Two complementary strands of DNA form a
double helix because the purine bases adenine (A) and guanine (G) form
specific pairs with the pyrimidine bases thymine (T) and cytosine (C),
attaching to each other through two or three docking sites.
This type of structure could also be the basis for the first genetic material.
However, it is doubtful that its backbone consisted of sugar and phosphate; it
may have consisted of peptide-like building blocks. Amino acids, from which
peptides are made, were already present in the primordial soup. However, the
bases may also have looked different in their primitive form.
To find the right track in searching for the origins of life, the team is
trying to put together groups of potential building blocks from which
primitive molecular information transmitters could have been made. The
researchers have taken a pragmatic approach to their experiments. Compounds
that they test do not need to fulfill specific chemical criteria; instead,
they must pass their genetic information on to subsequent generations just as
simply as the genetic molecules we know todayand their formation must have
been possible under prebiotic conditions.
Experiments with molecules related to the usual pyrimidine bases (pyrimidine
is a six-membered aromatic ring containing four carbon and two nitrogen
atoms), among others, seemed a good place to start. The team thus tried
compounds with a triazine core (a six-membered aromatic ring made of three
carbon and three nitrogen atoms) or aminopyridine core (which has an
additional nitrogen- and hydrogen-containing side group). Imitating the
structures of the normal bases, the researchers equipped these with different
arrangements of nitrogen- and hydrogen- and/or oxygen-containing side groups.
Unlike the usual bases, these components can easily be attached to many
different types of backbone, for example, a backbone made of dipeptides or
other peptide-like molecules. In this way, the researchers did indeed obtain
molecules that could form specific base pairs not only with each other, but
also with complementary RNA and DNA strands. Interestingly, only one
sufficiently strong pair was formed within both the triazine and aminopyridine
families; however, for a four-letter system analogous to the ACGT code, two
such strongly binding pairs are necessary.
Our results indicate that the structure of the bases, rather than the
structure of the backbone, was the critical factor in the development of our
modern genetic material, says Krishnamurthy. Many chain molecules are able to
adopt a suitable spatial structure, but only a few bases can enter into the
necessary specific pairing. In this, our alternative bases are clearly
inferior to the usual WatsonCrick bases. Based on our observations, we are
beginning to understand why the natural bases are optimal with regard to the
function they perform.

Citation: Ramanarayanan Krishnamurthy et al., Mapping the Landscape of
Potentially Primordial Informational Oligomers: Oligodipeptides and
Oligodipeptoids Tagged with Triazines as Recognition Elements / Mapping the
Landscape of Potentially Primordial Informational Oligomers: Oligodipeptides
Tagged with 2,4-Disubstituted 5-Aminopyrimidines as Recognition Elements,
Angewandte Chemie International Edition, doi: 10.1002/anie. 200603207
==
Scientists from 10 countries cooperated to work out how the 400 million
"letters" of rice DNA are arranged.
==
"One of the most astounding recent findings in the world of genetics is that
the human mutation rate (just within our reproductive cells) is at least 100
nucleotide substitutions (misspellings) per person per generation. (Kondrashin
2002.)
"Other geneticists would place this number at 175 (Nachman and Crowell, 2000).
These high numbers are now widely accepted within the genetics community.
Kimura (1979) discusses how that most mutations fit into the no-selection zone
and provides a graph to illustrate this.

references:

Muller, H.J. 1950. Our Load of Mutations. Amer. J Human Genetics 2:111-176.

Kondrashov, A. S. 2002. Direct estimate of human per nucleotide mutation rates
at 20 loci causing Mendelian diseases. Human Mutation 21:12-27.

Nachman, M. W. and S. L. Crowell. 2000. Estimate of the mutation rate per
nucleotide in humans. Genetics 156:297-304

Kimura, M. 1979. Model of effective neutral mutations in which selective
contraint is incorporated. PNAS 76:3440-3444.
==
Onychophorans have one of the least sexy mating systems ever.
The male just deposits a packet of sperm somewhere on the
female. Anywhere! He doesn't care. There's no romance here.
Then the skin under the packet dissolves and the sperm swim through the
body cavity to the ovaries.
Called velvet worms for their velvety skin.
==
Cockroaches include over 4,000 species of various shapes and sizes.
==
http://www.evolutionnews.org/
==
I think there is a serenity that comes from understanding, from being
able to solve a mystery. And the bigger the mystery, the greater the
serenity. When you think about the diversity, complexity, and beauty
of life -- the elegance of the apparent design of life -- it adds up
to a colossal mystery. And the solution, Darwin's solution, is quite
remarkably simple. My serenity comes from the satisfaction of seeing
a really, really neat, elegant explanation that can explain so much.
==
To quote Wikipedia on Cytochrome C: "Cytochrome c is a highly conserved
protein across the spectrum of species, found in plants, animals, and many
unicellular organisms. This, along with its small size (molecular weight about
12,000 daltons), makes it useful in studies of evolutionary divergence. Its
primary structure consists of a chain of 100 amino acids. The cytochrome c
molecule has been studied for the glimpse it gives into evolutionary biology.
Both chickens and turkeys have the identical molecule (amino acid for amino
acid) within their mitochondria, whereas ducks possess molecules differing by
one amino acid. Similarly, both humans and chimpanzees have the identical
molecule, while rhesus monkeys possess mitochondria differing by one amino
acid. "
==
The Origins of Life: From the Birth of Life to the Origin of Language
by John Maynard Smith and Eors Szathmary
==
I find it very disturbing that my research has been grossly misinterpreted to
support the idea of intelligent design. Intelligent design is NOT a testable
hypothesis and therefore has no place in science classrooms. Ms. Haverkos
points out the importance of challenging theories, which I fully support.
However, the way scientists challenge theories is by generating alternative
TESTABLE hypotheses and collecting data to TEST those hypotheses. Students of
science should certainly be taught to ask questions and to challenge
established ideas, but they should be taught to do so using the scientific
method. In addition, in order to generate intelligent questions that can
advance the field of biology, it is essential to have a basic understanding of
the field. The theory of evolution explains a tremendous amount of scientific
data and there are currently NO other viable theories to explain those data
that withstand scientific tests. Telling students to challenge an established
theory without either presenting a testable alternative hypothesis or
specifically encouraging students to develop their own testable alternative
hypothesis confuses them not only about the theory itself, but about the
entire process of doing science.
==
Fish of the suborder Anabantoidei have a rudimentary lunglike organ.
==
Complex, statistically improbable things are by their nature more difficult to
explain than simple, statistically probable things."
-- Richard Dawkins, from The New Humanist, the Journal of the
Rationalist Press Association, Vol 107 No 2
==
Source: http://physorg. com/news82132706 .html

Two nerve cells in direct contact
A fly, flying along a corridor, produces through its movement a constant shift
of the pictures of the environment on its eyes (illustrated with arrows). This
"vector field" must be analysed on a higher level of the visual centReR,
called the Lobula plate, so as to control and correct the flight course. Turns
are controlled by the direct connection of two nerve, the HSE cell (right) and
the H2-Zelle (left).
For the first time, scientists at the Max Planck Institute for Neurobiology in
Martinsried near Munich ( Germany ) have been able to show how two nerve cells
communicate with each other from different hemispheres in the visual centre.
This astoundingly simple circuit diagram could at a later date provide a model
for algorithms to be deployed in technical systems.
Movements in space create in humans and animals so-called optical flow fields
which are characteristic for the movement in question. In a forward movement,
the objects flow by laterally, objects at the front increase in size and
objects further away hardly change at all. At a higher level in the visual
centre in the brain, there must be a computation of the visual information, so
that animals can differentiate between their own movement and movement of their
environment and are able to correct their course if necessary.
It is important for the analysis of flow fields that the movement information
from both eyes is merged so that the whole flow field can be assessed. In
their current study, Karl Farrow, Jurgen Haag and Alexander Borst have for the
first time proved the direct link between two nerve cells, one in each half of
the brain, combining the movement signals from both the facetted eyes of a fly.
In the blow fly, the nerve cells that analyse optical flow fields, called
tangential cells, are located in the lobula plate. There are only 60 of these
tangential cells for each half of the brain and each of these 60 cells can be
identified individually. The scientists in Martinsried have looked closely at
one cell, the H2 cell. This cell exhibits a strong preference for rotational
flow fields such as that which arises when the fly turns around its body's
vertical axis. Interestingly, this cell seems initially to react only to the
movements in front of its own eye (ipsilateral), but remain blind to movements
in front of the other eye (contralateral). However, if the ipsilateral movement
stimuli are combined with the contralateral, it is seen that the latter do
indeed modulate the reactions to ipsilateral movement stimuli. "The preference
of the H2 cell for rotational stimuli is due to a non-linear coordination of
the movement stimuli from both eyes, and it was this non-linearity that we
wanted to investigate further," said Alexander Borst.
The next step was to analyse the circuit diagram of the tangential cells of
the lobula plate in detail. This was based on a multitude of experiments in
which the connections between the cells within one lobular plate and those
between the two hemispheres were examined. In the end it turned out that there
were two ways in which movement information from one half of the brain could
reach the H2 cell in the other: firstly, directly from the so-called HSE cell,
which is electrically linked to the H2 cell in the opposite hemisphere and
secondly, indirectly via the CH cell, which receives information via several
intermediate stops from the other half of the brain and which inhibits the H2
cell on the same side with chemical synapses. Both connections were in
principle suitable for achieving the effect described; however the question
remained: which of the two is the crucial one?
The Max Planck scientists therefore blocked the two possible routes
selectively with laser ablation (the cell is filled with fluorescent dye which
has a toxic effect when strongly stimulated) and tested sensitivity to rotation
in the H2 cell. A long series of these technically very difficult experiments
provided unambiguous proof: if the ipsilateral CH cell was destroyed, no
effect was seen on the rotation sensitivity of the H2 cell. However, if the
contralateral HSE cell was removed from the circuit, the rotation sensitivity
of the H2 cell disappeared. It was blind to the movement stimuli in front of
the other eye, irrespective of whether it was combined with the ipsilateral
movement stimuli.
Alexander Borst enthused about the discovery: "The genius of this circuitry is
in its simplicity: with a single electrical link between two cells from the
halves of the brain, one cell is selective for rotation flow fields." Whether
nature has constructed similarly simple mechanisms in mammals is still unclear
- the circuitry of the nerve cells in the relevant areas in the cerebral cortex
has not yet been sufficiently explained to allow experiments of this nature to
be carried out. And it is rather doubtful whether removing a single cell from
the many billions of cells in the cerebral cortex would have an effect.
Clearly, however, this does not mean that the findings made by the fly
researchers in Martinsried will be without consequence for other areas of
science. For example, engineers developing navigating robots and driving
assistance systems rely on simple and robust algorithms such as those realized
by nature in insects. The mechanisms of optical flow field analysis are
supremely suitable for technical implementation.
==
Thanks to advances in DNAtechnology, scientists can
now reconstruct new copies of old viruses.Last year
United States government scientists reconstructed the
virusthat caused the influenza epidemic of 1918. Now a
team of French scientists has rebuilt a virusthat
infected our apelike ancestors several million years ago.
==
Dolphin May Have 'Remains' of Legs
TOKYO -- Japanese researchers said Sunday that a bottlenose dolphin captured
last month has an extra set of fins that could be the remains of hind legs, a
discovery that may provide further evidence that ocean-dwelling mammals once
lived on land.
Fishermen captured the four-finned dolphin alive off the coast of Wakayama
prefecture (state) in western Japan on Oct. 28, and alerted the nearby Taiji
Whaling Museum, according to museum director Katsuki Hayashi.
Fossil remains show dolphins and whales were four-footed land animals about 50
million years ago and share the same common ancestor as hippos and deer.
Scientists believe they later transitioned to an aquatic lifestyle and their
hind limbs disappeared.
Whale and dolphin fetuses also show signs of hind protrusions but these
generally disappear before birth.
Though odd-shaped protrusions have been found near the tails of dolphins and
whales captured in the past, researchers say this was the first time one had
been found with well-developed, symmetrical fins, Hayashi said.
"I believe the fins may be remains from the time when dolphins' ancient
ancestors lived on land ... this is an unprecedented discovery," Seiji Osumi,
an adviser at Tokyo's Institute of Cetacean Research, said at a news
conference televised Sunday.
The second set of fins much smaller than the dolphin's front fins are about
the size of human hands and protrude from near the tail on the dolphin's
underside. The dolphin measures 8.92 feet and is about five years old,
according to the museum.
Hayashi said he could not tell from watching the dolphin swim in a musuem tank
whether it used its back fins to maneuver.
A freak mutation may have caused the ancient trait to reassert itself, Osumi
said. The dolphin will be kept at the Taiji museum to undergo X-ray and DNA
tests, according to Hayashi.
==
Fossil is missing link in elephant lineage
A pig-sized, tusked creature that roamed the earth some 27 million
years ago represents a missing link between the oldest known
relatives of elephants and the more recent group from which modern
elephants descended, an international team that includes University
of Michigan paleontologist William J. Sanders has found.
The group's findings, to be published this week in the Proceedings of
the National Academy of Sciences, suggest that mastodons and the
ancestors of elephants originated in Africa, in contrast to mammals
such as rhinos, giraffes and antelopes, which had their origins in
Europe and Asia and migrated into Africa. The dating of the new
fossil, discovered in the East African country of Eritrea, also
pushes the origins of elephants and mastodons five million years
farther into the past than previous records, Sanders said.
From 35 to 25 million years ago, representatives of the group known
as proboscideans (which includes elephants, mastodons and their close
relatives) lived only in Africa and Arabia, and most of them were
palaeomastodonts. These animals were shorter and smaller than today's
elephants, with short trunks and tusks and simple teeth that were all
in place at the same time, as human adult teeth are.
After 25 million years ago, larger proboscideans such as mastodons
and gomphotheres the ancestors of modern elephantsdominated the
scene. Elephant-sized, with long tusks and trunks, these advanced
proboscidans had more complex teeth that emerged more slowly, so that
each quadrant of the mouth had only one or two functional teeth in
place at a time.
"The new fossil from Eritrea is important because it shows aspects of
dental anatomy in common with the advanced group, including molars
with more cusps and complex crowns and the delayed maturation and
emergence of molars," said Sanders, an assistant research scientist
in the U-M Museum of Paleontology. But the creature that the new
fossil represents also had characteristics in common with
palaeomastodonts, namely smaller body size and a jaw structure that
suggests shorter tusks and trunk.
"In age and anatomy it is exactly the sort of intermediate
evolutionists would expect to bridge the gap between archaic and
advanced proboscideans, " Sanders said.
==
Consider the cytochrome-C protein (or enzyme) That protein
has been extensively studied and exists in all animals;
thus, it is a good candidate for evaluation regarding
evolution. It performs the function of electron transport
involved with oxidative phosphorylation. Studies have been
done to determine what different amino acids could exist
at the 110 different amino acid (AA) sites in this protein
and the molecule still effectively perform the function of
electron transport involved with oxidative phosphorylation.
Any AA for a certain site is considered functionally equivalent
if when it exists at that certain site the molecule still
performs it's biochemical function.
Cytochrome-C from one organism will work in another. As
evidence of the claim that cytochrome-c for one organism
can be functional in another, it has been shown that human
cytochrome-c is functional in yeast - a single celled
organism with its own version of cytochrome-c.
Certainly yeast is an organism very much different from humans.
All animals have cytochrome-c. By every test ever performed
it is interchangeable. Any form of cytochrome-c can operate
in any other organism.
Humans and chimpanzees have identical cytochrome-c molecules.
The odds of this happening by chance are less than 1 in
10^93 power.
For comparison purposes, human and howler monkey cytochrome-c
molecules have amino acid differences in seven places. Human
and mouse cytochrome-c molecules differ in 28 amino acid
locations. Human and yeast cytochrome-c differ in 51 amino
acid locations.
So scientists collected this data OBJECTIVELY and compared
that data to what would be expected from evolution through
natural selection. As it happens the results are exactly
what would be predicted by common descent so they support
evolution. The odds are very, very, very much against
any other explanation.
==
Hagfish and lancelet fibrillar collagens reveal that type II
collagen-based cartilage evolved in stem vertebrates
The origin of vertebrates was defined by evolution of a skeleton;
however, little is known about the developmental mechanisms responsible
for this landmark evolutionary innovation. In jawed vertebrates,
cartilage matrix consists predominantly of type II collagen
(Col2{alpha} 1), whereas that of jawless fishes has long been thought to
be noncollagenous. We recently showed that Col2{alpha}1 is present in
lamprey cartilage, indicating that type II collagen-based cartilage
evolved earlier than previously recognized. Here, we investigate the
origin of vertebrate cartilage, and we report that hagfishes, the sister
group to lampreys, also have Col2{alpha}1- based cartilage, suggesting
its presence in the common ancestor of crown-group vertebrates. We go on
to show that lancelets, a sister group to vertebrates, possess an
ancestral clade A fibrillar collagen (ColA) gene that is expressed in
the notochord. Together, these results suggest that duplication and
diversification of ColA genes at the chordate-vertebrate transition may
underlie the evolutionary origin of vertebrate skeletal tissues.
==
Even though a house cat does not breed with African
lions because of obvious physical incompatibilities,
it can breed with lynxes which breed with pumas which
breed with leopards which do breed with African lions.
--
ring species
The best-known case is herring
gull versus lesser black-backed gull. In Britain these
are clearly distinct species, quite different in colour.
Anybody can tell them apart. But if you follow the population
of herring gulls westward round the North Pole to North
America, then via Alaska across Siberia and back to Europe
again, you will notice a curious fact. The 'herring gulls'
gradually become less and less like herring gulls and more
and more like lesser black-backed gulls until it turns out
that our European lesser black-backed gulls actually are
the other end of a ring that started out as herring gulls.
At every stage around the ring, the birds are sufficiently
similar to their neighbours to interbreed with them. Until,
that is, the ends of the continuum are reached, in Europe.
At this point the herring gull and the lesser black-backed
gull never interbreed, although they are linked by a
continuous series of interbreeding colleagues all the way
round the world. The only thing that is special about ring
species like these gulls is that the intermediates are still
alive. All pairs of related species are potentially ring
species.
==
The honey bee is the third insect to have its genome mapped and joins the
fruit fly and mosquito in the exclusive club.
==
An amino acid, one of the building blocks of life, has been spotted in deep
space. If the find stands up to scrutiny, it means that the sorts of chemistry
needed to create life are not unique to Earth verifying one of astrobiology's
cherished theories.
This would add weight to ideas that life exists on other planets, and even
that molecules from outer space kick-started life on Earth.
Over 130 molecules have been identified in interstellar space so far,
including sugars and ethanol. But amino acids are a particularly important
find because they link up to form proteins, the molecules that run, and to a
large extent make up our cells.
Back in 1994, a team led by astronomer Lewis Snyder of the University of
Illinois at Urbana-Champaign announced preliminary evidence of the simplest
type of amino acid, glycine, but the finding did not stand up to closer
examination (New Scientist magazine, 11 June 1994, p 4).
Now Snyder and Yi-Jehng Kuan of the National Taiwan Normal University say they
really have found glycine. "We're more confident [this time]," says Kuan. "We
have strong evidence that glycine exists in interstellar space."
Huge blobs
The researchers monitored radio waves for the spectral lines characteristic of
glycine. They studied emissions from more locations than before - giant
molecular clouds, huge blobs of gas and dust grains. They have also identified
10 spectral lines at each location that correspond to the lines created by
glycine in the lab; before they had just two.
The discovery of glycine supports recent lab-based simulations of deep space,
which show that ices containing simple organic matter could form. When
researchers bathe those ices in ultraviolet light, amino acids are created.
"Glycine is the holy grail," says Jill Tarter, director of the Centre for SETI
Research at the SETI Institute in Mountain View. "Let's hope they've got it
this time."
==
New Type of Mouse Discovered in Cyprus
LONDON (AP) A previously unknown type of mouse has been discovered on the
island of Cyprus, apparently the first new terrestrial mammal species
discovered in Europe in decades.
The living fossil'' mouse has a bigger head, ears, eyes and teeth than other
European mice and is found only on Cyprus, Thomas Cucchi, a research fellow at
Durham University in northeast England, said Thursday. Genetic tests confirmed
that the new mouse was a new species and it was named Mus cypriacus, or the
Cypriot mouse, he said.
His findings appeared in the peer-reviewed journal Zootaxa, an international
journal for animal taxonomists.
The biodiversity of Europe has been combed through so extensively since
Victorian times that new mammal species are rarely found there, and few
scientists had expected new creatures as large as mice to be discovered on the
continent.
New mammal species are mainly discovered in hot spots of biodiversity like
Southeast Asia, and it was generally believed that every species of mammal in
Europe had been identified,'' Cucchi said. This is why the discovery of a new
species of mouse on Cyprus was so unexpected and exciting.''
Cucchi said a bat discovered in Hungary and Greece in 2001 was the last new
living mammal found in Europe. No new terrestrial mammal has been found in
Europe for decades, he said.
Cucchi compared the new mouse's teeth with those from mouse fossils collected
by paleontologists. The comparison showed the new mouse had colonized and
adapted to the Cypriot environment several thousand years before the arrival
of man, the university said in a statement.
The discovery indicated that the mouse survived man's arrival on the island
and now lived alongside common European house mice, whose ancestors had
arrived with man during the Neolithic period, the university said.
All other endemic mammals of Mediterranean islands died out following the
arrival of man, with the exception of two species of shrew. The new mouse of
Cyprus is the only endemic rodent still alive, and as such can be considered
as a living fossil,'' Cucchi, a Frenchman, said in a telephone interview.
Shrews are small mammals that resemble mice but have a long, pointed snout and
eat insects.
Cucchi, an archaeologist and expert on the origin and human dispersal of house
mice, found the new species of mouse while working in Cyprus in 2004. He was
examining the archaeological remains of mice teeth from the Neolithic period
and comparing them with those of four known modern-day European mice species,
to determine if the house mouse was the unwelcome byproduct of human
colonization of the island 10,000 years ago, the university said.
The discovery of this new species and the riddle behind its survival offers a
new area of study for scientists studying the evolutionary process of mammals
and the ecological consequences of human activities on island biodiversity,''
Cucchi said.
==
The chimpanzee is not our closest relative, it is the bonobo ape. We have
98.9 percent of their DNA. That 1.1 percent difference makes us us humans.
Chimpanzees, 98.5 percent; gorillas, 98 percent. Any human is a 99.9 percent
match to another. Among that one-tenth difference is a unique
mutation, a DNA marker, for each group in time and area..
==
THE MONKEY BUSINESS, by Niles Eldredge
==
Giant Sea Reptile Fossils Found in the Arctic
On the arctic island chain of Svalbard, scientists from Norway have discovered
what's being called a "treasure trove" of fossils belonging to 150-million-year
old giant reptiles that roamed the seas at the time of the dinosaurs.
The fossils, discovered about halfway between the Norwegian mainland and the
North Pole, are said to belong to two groups of extinct marine reptilesthe
plesiosaurs and the ichthyosaurs.
Researchers say these animals were the top predators living in what was then a
relatively cool, deep sea. One skeleton has been nicknamed The Monster because
of its enormous size.
===
Neanderthal 'butcher's shop' found near Somme
Neanderthal finds are like prehistoric buses. You wait for tens of thousands
of years, and then two important revelations come along together. French and
Belgian archaeologists have found proof that Neanderthals - mankind's closest
relatives - were living in near-tropical conditions, hunting rhinoceros and
elephant, close to what is now France's Channel coast 125,000 years ago.
No traces of Neanderthal activity have previously been found in north-west
Europe during this period - a 15,000-year interval between two ice ages.
Historians previously thought that Neanderthals, who thrived in cold
conditions, had failed to adapt to the warmer weather and had retreated to the
east or to the north. The new site at Caours, near Abbeville, close to the
mouth of the river Somme, proves that this was not so.
A two-year dig by two French government research bodies has uncovered evidence
of a Neanderthal "butcher's shop" on an ancient riverbank to which animals as
large as rhinoceros, elephant and aurochs, the forerunner of the cow, were
dragged. The Neanderthals - known to be squat, powerful people, who had
language and fire and buried their dead - sliced up the animals with flint
tools for their meat and pounded their bones for their marrow.
Earlier this month, British archaeologists reported that they had found
evidence that a few members of the species (Homo neanderthalis) may have
survived in caves in Gibraltar much later than was previously thought - until
about 28,000 years ago, or maybe even 24,000 years ago. Previously, it was
thought that they vanished about 30,000 years ago.
Both finds are potentially vital new pieces in the frustratingly incomplete
jigsaw of modern understanding of our tough and resourceful, near-human,
European predecessors. The problem is that the two discoveries seem to be part
of different jigsaw puzzles.
Jean-Luc Locht, a Belgian expert in prehistory at the French government's
archaeological service, was a researcher at Caours. "This is a very important
site, a unique site," he said. "It proves that Neanderthals thrived in a warm
northwest Europe and hunted animals like the rhinoceros and the aurochs, just
as they previously, and later, hunted ice-age species like the mammoth and the
reindeer.
"If we have lost the record of them elsewhere in this period, it must be
because the erosive action of the last ice age wiped the record clean."
No Neanderthal remains have been found so far on the new site on the Somme, or
among the new finds in Gibraltar. In both cases, their presence at a particular
(and highly significant) period has been revealed by other discoveries: flint
tools in the case of Gibraltar' a treasure trove of flint tools and fossilised
animal bones in the case of the Somme.
The animal bones, found in a geological layer laid down about 125,000 years
ago, show signs of having been sawn through, crushed or stripped of their meat
by flint tools. The animal species identified include a small fragment of
elephant bone, several rhinoceros teeth, and many remnants of aurochs, wild
boar and several kinds of deer.
The dig, which will continue next summer, has also unearthed flint scraping or
cutting tools and a flint pounding implement, used for crushing bones or
splitting other pieces of flint.
Patrick Auguste, one of the other principal researchers on the site, an expert
on archaeozoology, or prehistoric animals, at the French national research
body, the CNRS, said: "You have to wonder at the artistry, the exceptional
skill, with which the flint tools have been shaped. The Neanderthals may have
had thicker fingers than us, but they were certainly not clumsy."
The back-to-back French and British announcements create a prehistorical
conundrum. The Gibraltar discovery suggests that Neanderthals survived for as
long as 8,000 years after a two-legged rival first appeared in Europe out of
Africa -Homo sapiens sapiens, or mankind. An 8,000-year period of Neanderthal/
sapiens cohabitation suggests that mankind was not responsible for wiping out
the Neanderthals.
The other possible explanation is that Neanderthals were victims of global
warming, succumbing to abrupt variations in climate well before the end of the
last Ice Age, about 15,000 years ago.
But the new find in the Somme suggests that Neanderthals were able to survive
the ending of an earlier ice age.
In which case, the finger of "blame" for the demise of the Neanderthals after
thriving in Europe for 270,000 years points, once again, at Homo sapiens.
==
There are 20,000 genes that animate the brain of the common mouse
Weighing little more than a teaspoon of sugar, a mouse brain may be
considerably smaller than the human brain, but both require thousands of genes
acting in complex combinations to develop and function. Mice and men share
almost 90 percent of their genes.
==
Fred Hoyle The Mathematics of Evolution
==
There is a flower that attracts only one type of bee which happens to subsist
on the nectar from only that particular plant, which when only that particular
bee lands inside it, will close up and trap the bee for a few days or a week,
feeding the bee while the bee pollenated the plant.
The plant is parasitic on a vine called Tetrastigma, which is related to
grapes. It's not parasitic on any animal of any kind.
==
Rafflesia flower, Sabah, Malaysia. Rafflesia is the largest known
flower. The plant is a parasite and has no leaves or stem. The flower
has the odor and color of rotting meat and is pollinated by flies.
The flowers are close to three feet in diameter.
(https://netfiles. uiuc.edu/ ro/www/DarwinClu b/index.html)
===
The first stone tools appear at 2.35 mya
==
A recent study by a pair of Swedish scientists, Dan Nilson and Susanne Pelger,
suggests that a ludicrously small fraction of that time would have been plenty.
When one says 'the' eye, by the way, one implicitly means the vertebrate eye,
but serviceable image-forming eyes have evolved between 40 and 60 times,
independently from scratch, in many different invertebrate groups. Among these
40-plus independent evolutions, at least nine distinct design principles have
been discovered, including pinhole eyes, two kinds of camera-lens eyes,
curved-reflector ('satellite dish') eyes, and several kinds of compound eyes.
Nilsson and Pelger have concentrated on camera eyes with lenses, such as are
well developed in vertebrates and octopuses."
===
The human brain went from 600 cubic centimeters to 1,450 cc in only a few
million years.
==
Neanderthals were thought to have died out as modern humans arrived in Europe.
Now, artifacts found in a cave in Gibraltar reveal that the two groups
coexisted for millenia before Neanderthals finally dwindled out of existence.
Homo sapiens moved into Europe about 32,000 years ago. But the newly
unearthered artefacts shows that a remnant population of Homo neanderthalensis
clung on until at least 28,000 years ago, a significant overlap.
Clive Finlayson at the Gibraltar Museum, and colleagues, recovered 240 stone
tools and artefacts from sediments dated to the Upper Palaeolithic period
between 10,000 and 30,000 years ago. Mass spectrometry dating puts them
between 28,000 and 24,000 years old.
The exciting point is that the tools are all of a type known to
palaeontologists as Mousterian: they are flints, cherts and quartzites
exclusively associated with Neanderthal manufacture.
Mousterian technology is firmly associated with Neanderthals across Europe,
says Finlayson, who adds that in the sediment layers where the tools where
found there is no hint of intrusion from more recent layers, and no sign of
tools made by modern humans.
Genetically distinct
Since modern humans and Neanderthals seem to have overlapped for thousands of
years in Europe, the big question is: did they interbreed?
The consensus now sees Neanderthals as having been largely replaced rather
than assimilated into the modern human gene pool, says Katerina Harvati, at
the department of human evolution at the Max Planck Institute for Evolutionary
Anthropology in Leipzig, Germany. Genetic evidence from several Neanderthals
shows that they were very distant genetically in their mitochondrial DNA from
modern humans.
So, if they did interbred, the Neanderthal genes did not survive. The more
realistic demographic models suggest that admixture (gene mixing) was
unlikely, and probably minimal or zero, says Harvati.
The finding has implications for the status of a skeleton known as the Lagar
Velho child. This individual, purported to be a hybrid of a Neanderthal and a
modern human, was found in Portugal and has been dated to 24,500 years ago.
Hanging in there
Lagar Velho's juvenile nature has made it difficult to determine if it is
indeed a hybrid, and one of the other objections has been the fact that it
lived thousands of years after the Neanderthals were thought to have died out.
Clearly, our results show Neanderthals may have been around at the time, says
Finlayson.
The site of the discovery in Gibraltar is Gorhams Cave, where Neanderthal
artefacts were first discovered more than 50 years ago. Animal bones found
with the tools indicate that the occupants butchered their hunted prey in the
cave. The environment is rich and diverse, which perhaps enabled the last of
the Neanderthal stragglers to survive a little longer than most. Finlayson
estimates that only a small group lived in the cave itself.
Although modern humans were breeding all around them, we are not thought to
have actively exterminated the Neanderthals.
Fragmented populations survived in southern localities and their final
extinction may have been due to their small numbers, says Finlayson. Modern
humans played a minor or no role in this.
==
Global Warming Shows Up in Fly Genes
Climate warming over the last quarter century is writ large in tiny fruit
flies, according to a genetic analysis. In a species of fruit fly, the
frequencies of so-called inversions, in which a piece of chromosome is flipped
around, were observed decades ago to correspond to the latitude at which the
flies were found. In nearly all the sites where the flies have recently been
sampled--a span of three continents--the frequency of specific inversions has
increased hand in hand with climbing temperatures. "It's a very clear signal
that climate warming is going to have a big impact on our environment,
==
There are well over 300,000 species of just beetles.
There are many insects. Peterson's
Field Guide to North American Insects only covers insects down to the
family level (and even some of them it clusters together or doesn't
bother to illustrate), for goodness sakes, and it's still one of their
thickest field guides. There are more species of insect on the planet
than there are species of all other animals put together.
Distinguishing most of them isn't really something ordinary people
are qualified to do. Sure, some are relatively easy (most
butterflies) , but by and large, there are more differences between
individuals of the same species than there are between that species
and another. Identifying to species can rely on very obscure
characters. Many insects cannot be identified to species unless they
are caught and have their genitals examined under microscopes,
possibly after partial dissection. This may seem extreme, but
sometimes, this is the ONLY way to identify them. Genital differences
seem important in insects, blocking wasteful mating between species.
For insects that depend on camoflage, there's no reason to change
their obvious appearance, just adjust the genitals to reflect
speciation.
===
About 90 million years ago, some mammals adopted diets that set them on an
evolutionary path to becoming primates: They began to eat fruits and nectar.
About 60 million years ago, primates had branched into two groups: the Old
World monkeys and apes (including us) and the lemurs of Madagascar.
The Old World monkeys then branched again about 35 million years ago, when some
went to South America and became the New World monkeys.

Snakes evolved about 100 million years ago.)
==
Some mites are species whose males rape other male mites, injecting their sperm
into their victims seminal tubes. The next few times the victim mates, hes
spreading his attackers genes instead of his own!
==
Science has discovered that moral behaviour is something that can evolve
naturally out of the need to keep the species alive.
There also seems to be a significant kinship component, protecting those
individuals most likely to share your genes. Human history shows that its
generally been considered moral to slaughter neighboring tribes, especially
their men, and take their resources to share amongst your tribe.
==
Single-celled Dictyostelium purpureum, a common soil microbe that feeds on
bacteria. In the wild, when food runs short, D. purpureum aggregate together
by the thousands, forming first into long narrow slugs and then into hair-like
fruiting bodies. Resembling miniature mushrooms, these fruiting bodies consist
of both a freestanding stalk and the spores that sit atop it. Ultimately, the
spores are carried away, usually on the legs of passing creatures, to start
the life cycle all over again. But in order to disperse the spores, some of
the colony's individuals must altruistically sacrifice themselves in order to
make the stalk.
==
In the northeastern
United States, for example, are found two species of tree frogs, Hyla
versicolor and Hyla chrysoscelis. The two are absolutely identical in
appearence, and the only way to distinguish them in the field is by their
slightly differing mating calls. One of these species is a "polyploid" of
the other, that is, it developed from the other species when a chromosomal
abnormality left some individuals with twice the normal number of
chromosomes. (Polyploidy is a very common means of plants to produce new
species--in fact, most domesticated food plants like wheat and rye are
polyploids--but is comparitively rare among animals.) There is no doubt
that the two frogs share an ancestor/descendent relationship, and that one
evolved from the other through polyploidy."
==
NEWS: Scientists Identify Gene Difference Between Humans and Chimps
The DNA sequences of humans and chimpanzees are 98 percent identical. Yet that
2 percent difference represents at least 15 million changes in our genome since
the time of our common ancestor roughly six million years ago. Now a new
computational technique has identified 49 regions that have changed
particularly quickly between humans and chimps, and may have revealed at least
one gene critical to the development of our larger brains.
==
Cyanobacteria such as Prochlorococcus were the planet's first oxygen-producing
creatures and are, in a broad sense, the ancestors of all higher plants.
==
"Human Evolution." Svante Paabo. Trends in Genetics. 15(12): M13-M16, 1999.
"Neanderthal DNA Sequences and the Origin of Modern Humans." Matthias Krings,
et al. Cell, July 11, 1997.
"Mitochondrial DNA and Human Evolution." Rebecca L. Cann, Mark Stoneking, Allan
C. Wilson. Nature, January 1, 1987.
"The Case of Mitochondrial Eve." Frank R. Zindler. American Atheist, February
1988.
Shreeve, James. The Neanderthal Enigma: Solving the Mystery of Modern Human
Origins. New York: Avon Books, 1995.
Stringer, Christopher; Clive Gamble. In Search of the Neanderthals: Solving the
Puzzle of Human Origins. New York: Thames and Hudson, Inc., 1993.
==
The chromosomes hold the vast bulk of genetic information that you've
inherited from your parents.
Outside the nucleus, but still within the cell, lie mitochondria. Mitochondria
are tiny structures that help cells in a number of ways, including producing
the energy that cells need. Each mitochondrion -- there are about 1,700 in
every human cell -- includes an identical loop of DNA about 16,000 base pairs
long containing 37 genes. In contrast, nuclear DNA consists of three billion
base pairs and an estimated 70,000 genes. (This estimate has been revised
upward several times since the announcement that the human genome had been
decoded, and likely will be again.)
==
No, geology is not based on "evolutionary bias"
-----------------------------------------------
One of the Big Lie tactics of young earth creationists is to go around
claiming "The idea of the antiquity of the Earth in geology (and the
antiquity of the Universe in astronomy) is based on evolutionary bias."
As usual, the truth is otherwise...
Historically, just as one example, the geologic column had been
discovered by geologists and was being discussed in geology articles and books
decades before the 1859 publication of *Origin of Species* by Charles Darwin.
See: "Homo sapiens Deciphers Geologic Time"
by Richard Miller (Geologist, San Diego State University, Professor Emeritus)
http://www-rohan.sdsu.edu/~rhmiller/geologictime/GeologicTime.htm
Conceptually, neither geology nor astronomy are based on any
assumptions regarding biological evolution. They are simply independent fields
of science whose discoveries and concepts concerning the antiquity of the Earth
and the antiquity of the Universe have nothing to do with biological evolution.
Indeed, it's rather peculiar and hypocritical for young earth
creationists to be complaining about unscientific bias in the first place,
because the fact of the matter is that it is young earth creationist who
espouse young earth creationism on the basis of totally unscientific bias:
From:
http://www.icr.org/index.php?module=research&action=index&page=research_tenets
==
One of the Big Lie tactics of young earth creationists is to go around
claiming "Evolution is not science" or "Evolution is a religion." As usual,
the truth is otherwise...

There are hundreds of scientific research articles about evolution published
each and every year. Here's a selection of professional science journals (in
the U.S. and the U.K.) that routinely or exclusively publish professional
scientific research concerning evolution:

References on Evolution
-----------------------

The Paleontological Society Position Statement: Evolution
http://www.paleosoc.org/evolutioncomplete.htm

Evolution is both a scientific fact and a scientific theory.
Evolution is a fact in the sense that life has changed through time.
In nature today, the characteristics of species are changing, and
new species are arising. The fossil record is the primary factual
evidence for evolution in times past, and evolution is well
documented by further evidence from other scientific disciplines,
including comparative anatomy, biogeography, genetics, molecular
biology, and studies of viral and bacterial diseases. Evolution is
also a theory an explanation for the observed changes in life
through Earth history that has been tested numerous times and
repeatedly confirmed. Evolution is an elegant theory that explains
the history of life through geologic time; the diversity of living
organisms, including their genetic, molecular, and physical
similarities and differences; and the geographic distribution of
organisms. Evolutionary principles are the foundation of all basic
and applied biology and paleontology, from biodiversity studies to
studies on the control of emerging diseases.

Because evolution is fundamental to understanding both living and
extinct organisms, it must be taught in public school science
classes. In contrast, creationism is religion rather than science,
as ruled by the Supreme Court, because it invokes supernatural
explanations that cannot be tested. Consequently, creationism in any
form (including "scientific creationism," "creation science,"
and "intelligent design") must be excluded from public school
science classes. Because science involves testing hypotheses,
scientific explanations are restricted to natural causes.

This difference between science and religion does not mean that the
two fields are incompatible. Many scientists who study evolution are
religious, and many religious denominations have issued statements
supporting evolution. Science and religion address different
questions and employ different ways of knowing.

The evolution paradigm has withstood nearly 150 years of scrutiny.
Although the existence of evolution has been confirmed many times,
as a science evolutionary theory must continue to be open to
testing. At this time, however, more fruitful inquiries address the
tempo and mode of evolution, various processes involved in
evolution, and driving factors for evolution. Through such inquiry,
the unifying theory of evolution will become an even more powerful
explanation for the history of life on Earth.

----------------------------------------------------------------

The Society of Vertebrate Paleontology
Statement on Evolution (1994)
http://www.vertpaleo.org/policy/policy_statement_evolution.html

Excerpt:
The fossil record of vertebrates unequivocally supports the
hypothesis that vertebrates have evolved through time, from
their first records in the early Paleozoic Era about 500
million years ago to the great diversity we see in the world
today. The hypothesis has been strengthened by so many
independent observations of fossil sequences that it has come
to be regarded as a confirmed fact, as certain as the drift of
continents through time or the lawful operation of gravity.

----------------------------------------------------------------

National Academy of Sciences
Science and Creationism: A View from the National Academy of
Sciences, Second Edition (1999)
http://www.nap.edu/books/0309064066/html/

Excerpt:
Is evolution a fact or a theory?
|
The theory of evolution explains how life on Earth has
changed. In scientific terms, "theory" does not mean "guess"
or "hunch" as it does in everyday usage. Scientific theories
are explanations of natural phenomena built up logically
from testable observations and hypotheses. Biological
evolution is the best scientific explanation we have for the
enormous range of observations about the living world.
|
Scientists most often use the word "fact" to describe an
observation. But scientists can also use fact to mean
something that has been tested or observed so many times
that there is no longer a compelling reason to keep testing
or looking for examples. The occurrence of evolution in this
sense is a fact. Scientists no longer question whether
descent with modification occurred because the evidence
supporting the idea is so strong.

----------------------------------------------------------------

American Geological Institute
Position on Teaching Evolution
http://www.agiweb.org/gapac/evolution_statement.html

Excerpt:
Scientific evidence indicates beyond any doubt that life has
existed on Earth for billions of years. This life has evolved
through time producing vast numbers of species of plants and
animals, most of which are extinct. Although scientists debate
the mechanism that produced this change, the evidence for the
change is undeniable.

----------------------------------------------------------------

Geological Society of America
Position Statement on Evolution (2001)
http://rock.geosociety.org/docs/aboutus/position1.htm

Excerpt:
The Geological Society of America recognizes that the
evolution of life stands as one of the central concepts of
modern science. Research in numerous fields of science during
the past two centuries has produced an increasingly detailed
picture of how life has evolved on Earth.

----------------------------------------------------------------

Botanical Society of America
Statement on Evolution
http://www.botany.org/newsite/announcements/evolution.php

Evolution represents one of the broadest, most inclusive
theories used in pursuit of and in teaching this knowledge,
but it is by no means the only theory involved. Scientific
theories are used in two ways: to explain what we know, and to
pursue new knowledge. Evolution explains observations of
shared characteristics (the result of common ancestry and
descent with modification) and adaptations (the result of
natural selection acting to maximize reproductive success), as
well as explaining pollen:ovule ratios, weeds, deceptive
pollination strategies, differences in sexual expression,
dioecy, and a myriad of other biological phenomena. Far from
being merely a speculative notion, as implied when someone
says, "evolution is just a theory," the core concepts of
evolution are well documented and well confirmed. Natural
selection has been repeatedly demonstrated in both field and
laboratory, and descent with modification is so well
documented that scientists are justified in saying that
evolution is true.

----------------------------------------------------------------

American Association of Physics Teachers
Statement on the Teaching of Evolution and Cosmology
http://www.aapt.org/Policy/evolutandcosmo.cfm

Excerpt:
Evolution and cosmology represent two of the unifying concepts
of modern science. There are few scientific theories more
firmly supported by observations than these: Biological
evolution has occurred and new species have arisen over time,
life on Earth originated more than a billion years ago, and
most stars are at least several billion years old.
Overwhelming evidence comes from diverse sources - the
structure and function of DNA, geological analysis of rocks,
paleontological studies of fossils, telescopic observations of
distant stars and galaxies - and no serious scientist
questions these claims.

----------------------------------------------------------------

The Society of Systematic Biologists
Support for the Teaching of Evolution and Scope of Systematic Biology
(2001)
http://systbiol.org/teachevolution.html

Ecological Society of America
Position Statement on Evolution (1999)
http://www.esa.org/pao/esaPositions/Statements/Evolution.php

Genetics Society of America
Statement on Evolution and Creationism (2003)
http://genetics.faseb.org/genetics/g-gsa/statement_on_evolution.shtml

Society for the Study of Evolution
Statement on Evolution
http://www.evolutionsociety.org/statements.html

American Institute of Biological Sciences
AIBS Endorsed Statement on Evolution, Science, and Society:
Evolutionary Biology and the National Research Agenda (1998)
http://www.aibs.org/position-statements/980602_aibs_endorsed_st.html
http://evonet.sdsc.edu/evoscisociety/

American Anthropological Association
Statement on Evolution and Creationism (2000)
http://www.aaanet.org/stmts/evolution.htm

American Society of Naturalists
Statement on Evolution and Education
http://www.journals.uchicago.edu/ASN/evo.html

American Geophysical Union
Earth History and the Evolution of Life Must Be Taught: Creationism Is
Not Science
http://www.agu.org/sci_soc/policy/positions/evolution.shtml

American Physical Society
Statement On The Kansas State Board Of Education Decision (1999)
http://www.aps.org/statements/99_5.cfm

Society of Physics Students
Statement on Evolution and Science Education (2003)
http://www.spsnational.org/info/2003_sps_statement.htm

American Chemical Society
Statement on Teaching of Evolutionary Theory
http://www.chemistry.org/portal/a/c/s/1/feature_pol.html?id=
c373e904891eddda8f6a17245d830100
[link
may be line-wrapped]

American Astronomical Society
Statement on the Teaching of Evolution
http://www.aas.org/governance/council/resolutions.html#teach

American Association for the Advancement of Science
AAAS Board Resolution on Intelligent Design Theory
http://www.aaas.org/news/releases/2002/1106id2.shtml

National Association of Biology Teachers
Statement on Teaching Evolution
http://nabt.org/sub/position_statements/evolution.asp

National Science Teachers Association
Position Statement on the Teaching of Evolution
http://www.nsta.org/positionstatement&psid=10

----------------------------------------------------------------

American Society of Agronomy
Crop Science Society of America
Soil Science Society of America
Position Statement by ASA, CSSA, and SSSA Executive Committees in
Support of Teaching Evolution (8/11/2005)
http://www.asa-cssa-sssa.org/pdf/intdesign_050815.pdf

Intelligent design is not a scientific discipline and should
not be taught as part of the K-12 science curriculum.
Intelligent design has neither the substantial research base,
nor the testable hypotheses as a scientific discipline. There
are at least 70 resolutions from a broad array of scientific
societies and institutions that are united on this matter. As
early as 2002, the Board of Directors of the American
Association for the Advancement of Science (AAAS) unanimously
passed a resolution critical of teaching intelligent design in
public schools.
|
The intelligent design/creationist movement has adopted the
lamentable strategy of asking our science teachers to "teach
the controversy" in science curriculums, as if there were a
significant debate among biologists about whether evolution
underpins the abundant complexity of the biological world. We
believe there is no such controversy.
|
The fundamental tenet of evolution descent with modification
is accepted by the vast majority of biologists. The current
debates within the research community deal with the patterns
and processes of evolution, not whether the evolutionary
principles presented by Darwin in 1859 hold true. These
debates are similar to those surrounding the relativistic
nature of gravitational waves. No one doubts the existence of
gravity just because we are still learning how it works;
evolution is on an equally strong footing.
|
The discussion of lifes spirituality is most appropriate for
philosophy or religion classes. It is a mistake to conclude
that reluctance to incorporate spiritual questions in science
classes runs counter to the cherished principle that vigorous
challenge is vital to the scientific method.
|
In all scientific fields, including evolutionary biology,
challenge has always been essential and welcomed. Scientific
challenge succeeds if it is methodical and findings are
verified to the satisfaction of the scientific community. This
has not happened with creationism either with or without its
new label intelligent design. President Bush, by suggesting
that we use intelligent design as a scientific counterpoint to
the teaching of evolutionary biology, is unwittingly
undermining the scientific method at its core. This is most
unfortunate in an era when U.S. students are already lagging
behind their international peers in science education.

================================================================

The Imminent Demise of Evolution: The Longest Running Falsehood in
Creationism (2002)
by Glenn R. Morton
http://home.entouch.net/dmd/moreandmore.htm

Understanding Evolution
http://evolution.berkeley.edu/

Counterbalance Meta Library (views on science, ethics, philosophy, and
religion)
Evolution Section
http://www.counterbalance.org/evolution/

Evolution, Science, and Society
http://www.rci.rutgers.edu/~ecolevol/fulldoc.pdf

Synthetic Theory of Evolution: An Introduction to Modern Evolutionary
Concepts and Theories
http://anthro.palomar.edu/synthetic/


Understanding Evolution
http://evolution.berkeley.edu/

Counterbalance Meta Library - Evolution
http://www.counterbalance.net/evolution/index-frame.html

PBS - Evolution
http://www.pbs.org/wgbh/evolution/

Synthetic Theory Of Evolution: An Introduction to Modern Evolutionary Concepts
and Theories
http://anthro.palomar.edu/synthetic/

Introduction to Evolutionary Biology
http://www.talkorigins.org/faqs/faq-intro-to-biology.html

Basic Misconceptions About Evolution
http://www.abarnett.demon.co.uk/atheism/evolution.html

Evolution (2005)
by Douglas J. Futuyma
http://www.amazon.com/gp/product/0878931872

Finding Darwin's God (1999)
by Kenneth R. Miller
http://www.amazon.com/gp/product/0060175931

The Blind Watchmaker (1996)
by Richard Dawkins
http://www.amazon.com/gp/product/0393315703

Evolution: The Triumph of an Idea (2001)
by Carl Zimmer
http://www.amazon.com/gp/product/0060199067

Science on Trial: The Case for Evolution, 2nd Ed. (1995)
by Douglas Futuyma
http://www.amazon.com/gp/product/0878931848

================================================================

References on Geology and Paleontology
-------------------------------------

Radiometric Dating: A Christian Perspective
by Dr. Roger C. Wiens
http://www.asa3.org/ASA/resources/Wiens.html

Radiometric Dating and the Geological Time Scale
by Andrew MacRae
http://www.talkorigins.org/faqs/dating.html

Radiometric Time Scale
by Kathie Watson (U.S. Geological Survey)
http://pubs.usgs.gov/gip/geotime/radiometric.html

An Essay on Radiometric Dating
by Jonathon Woolf
http://www.jwoolfden.com/rad_dat.html

This Dynamic Earth: The Story of Plate Tectonics
by W. Jacquelyne Kious and Robert I Tilling (U.S. Geologic Survey)
http://pubs.usgs.gov/gip/dynamic/dynamic.html

Fossils, Rocks, and Time
by Lucy E. Edwards and John Pojeta, Jr.
http://pubs.usgs.gov/gip/fossils/contents.html

Evolution of the Earth, 7th Ed. (2003)
by Donald R. Prothero and Robert H. Dott, Jr.
http://www.amazon.com/gp/product/0072528087

Structural Geology of Rocks and Regions, 2nd Ed. (1996)
by George H. Davis and Stephen J. Reynolds
http://www.amazon.com/gp/product/0471526215

Bringing Fossils To Life, 2nd Ed. (2003)
by Donald R. Prothero
http://www.amazon.com/gp/product/0073661708

Science and Earth History: The Evolution/Creation Controversy, 2nd Ed. (1999)
by Arthur N. Strahler
http://www.amazon.com/gp/product/1573927171

PLoS Biology
(published by the Public Library of Science)
http://biology.plosjournals.org/

PLoS Genetics
(published by the Public Library of Science)
http://genetics.plosjournals.org/

Science
(published by the American Association for the Advancement of Science)
http://www.sciencemag.org/

Nature
http://www.nature.com/

Journal of Biology
(published by BioMed Central)
http://jbiol.com/

Journal of Evolutionary Biology
http://www.blackwellpublishing.com/journal.asp?ref=1010-061X
view online content:
http://www.blackwell-synergy.com/rd.asp?code=JEB&goto=journal

International Journal of Organic Evolution
http://evol.allenpress.com/evolonline/?request=index-html#Evolution_Journal
[link may be line-wrapped]

Molecular Biology and Evolution
(published by the Society for Molecular Biology and Evolution)
http://www.mbe.oupjournals.org

Evolution & Development
http://www.blackwellpublishing.com/journal.asp?ref=1520-541X

Trends in Ecology & Evolution
http://www.elsevier.com/wps/find/journaldescription.cws_home/30339/description
[link may be line-wrapped]

Trends in Genetics
http://www.elsevier.com/wps/find/journaldescription.cws_home/405918/description
[link may be line-wrapped]

Integrative and Comparative Biology
(Journal of the Society for Integrative and Comparative Biology; published as
the American Zoologist from 1961 to 2001)
http://www.sicb.org/az/

Invertebrate Biology
(Journal of the American Microscopical Society)
http://www.invertebratebiology.org/

Proceedings of the National Academy of Sciences (PNAS)
Biological Sciences
http://www.pnas.org/current.shtml#BIOLOGICAL_SCIENCES

Palobiology
Journal of Paleontology
(both published by The Paleontological Society)
http://www.psjournals.org/paleoonline/?request=get-archive

The Journal of Vertebrate Paleontology
(published by the Society of Vertebrate Paleontology)
http://www.vertpaleo.org/jvp/

Paleontologia Electronica
http://palaeo-electronica.org/

Cladistics
The International Journal of the Willi Hennig Society
http://www.blackwellpublishing.com/journal.asp?ref=0748-3007

Evolution
International Journal of Organic Evolution
http://evol.allenpress.com/evolonline/?request=get-archive

Biological Journal of the Linnean Society
http://www.blackwellpublishing.com/journal.asp?ref=0024-4066

Zoological Journal of the Linnean Society
http://www.blackwellpublishing.com/journal.asp?ref=0024-4082

Botanical Journal of the Linnean Society
http://www.blackwellpublishing.com/journal.asp?ref=0024-4074

Evolutionary Ecology
(published in the Netherlands)
http://www.springer.com/west/home/life+sci?SGWID=4-10027-70-35681186-0
[link may be line-wrapped]

Genetics
http://www.genetics.org/

Molecular Phylogenetics and Evolution
http://www.elsevier.com/wps/find/journaldescription.cws_home/622921/description
[link may be line-wrapped]

Proceedings of the Royal Society: Biological Sciences
http://www.pubs.royalsoc.ac.uk/index.cfm?page=1087

Journal of Zoological Systematics and Evolutionary Research
http://www.blackwellpublishing.com/journal.asp?ref=0947-5745

Evolutionary Bioinformatics Online
http://www.la-press.com/evolbio.htm
==
Breaking the Spell: Religion as a Natural Phenomenon, Daniel C. Dennett,
The God Delusion, Richard Dawkins,

Six Impossible Things Before Breakfast, by Lewis Wolpert

E. O. Wilson of Harvard The Creation.

Gods Universe, Dr. Gingerich, an emeritus professor of astronomy at Harvard,

Evolution and Christian Faith, Dr. Roughgarden

The Reluctant Mr. Darwin: An Intimate Portrait of Charles Darwin and the Making
of His Theory of Evolution
David Quammen
Atlas Books/W.W. Norton: 304 pp., $22.95
*
Intelligent Thought: Science Versus the Intelligent Design Movement
Edited by John Brockman
Vintage: 258 pp., $14 paper
*
Why Darwin Matters: The Case Against Intelligent Design
Michael Shermer
Times Books/Henry Holt: 202 pp., $22

http://www.users.bigpond.net.au/academic/essays/Propagational%20Selection.pdf
essay on evolution
==
Researchers discover new type of cricket
HURRICANE, Utah - Researchers say they have discovered a new type of cricket
in the Grand Canyon-Parashant National Monument, located in a remote strip of
land on the Utah-Arizona border.
The cricket was discovered in samples taken from the area last spring by Kyle
Voyles, a state of Arizona cave coordinator and a physical science technician
with the Bureau of Land Management, and J. Judson Wynne, a Northern Arizona
University doctoral candidate.
Voyles and Wynne spent time surveying 24 caves and taking samples from 15.
"Finding a new species is one thing, but finding a new genus is beyond my
wildest dream," Kyle Voyles, a state of Arizona cave coordinator said. A genus
is a broader category in the classification of animals; it can encompass many
related species.
The monument is under joint management of the BLM and the National Park
Service and covers more than 1,600 square miles of land on what's known as the
Arizona Strip. The area's deep canyons, mountains and red rock buttes are cut
off from the rest of Arizona by the Grand Canyon at its south border.
"One thing I love about the Arizona Strip is its untouched, untapped natural
resources," Voyles said. "It may not be a big tourist draw, but there are a
lot of potentially big important discoveries out there."
The new cricket was found in the first sample bottle. Voyles said Theodore
Cohn, an entomologist with San Diego State University, identified the crickets
as a new genus.
In addition to the possible new genus of cricket, four new species of crickets
have been identified from the spring samples. A barklouse also was found in the
caves. Though common in South America, this was the first one discovered in
North America, Voyles said.
Previous cave trips yielded two new species of millipedes within three miles
of each other.
What makes the yet-to-be-named new genus of cricket special is that it has
pincers on its hind end. The pincers are functional, but it is not known why
they have them nor what purpose they serve.
The discovery at the monument, which was dedicated in January, may draw
attention to caves that are largely overlooked in an area where the
inhabitants have to learn to adapt to harsh living conditions.
Jeff Bradybaugh, superintendent of the Grand Canyon-Parashant National
Monument, said the discoveries are very exciting.
"It points to some of the uniqueness of the area and the undiscovered natural
resources," Bradybaugh said. "This might attract funding from nongovernment
sources and help develop partnerships with universities to continue the
research."
==
The Origin of Mind: Evolution of Brain, Cognition,
and General Intelligence
David C. Geary
Washington, D.C. American Psychological Association, 2005.
459 pages. $59.95 hardcover.
==
Analysis suggested that around 1800 genes, or roughly 7% of the total in
the human genome, have changed under the influence of natural selection within
the past 50,000 years. A second analysis using a second SNP database gave
similar results. That is roughly the same proportion of genes that were
altered in maize when humans domesticated it from its wild ancestors.

Moyzis speculates that we may have similarly domesticated ourselves with the
emergence of modern civilisation.

One of the major things that has happened in the last 50,000 years is the
development of culture, he says. By so radically and rapidly changing our
environment through our culture, weve put new kinds of selection [pressures]
on ourselves.
==
When biologists talk about evolution and the survival of the fittest, they
do not necessarily mean the strongest, fastest or smartest. Fitness is
whatever works in a particular environment, and the new research shows that
as environments change, notions of fitness change, too.
===
"...To deny that basic concepts of historical method with respect to
evolution is worse than just denying science; it is denying simple
common sense. Down that road lies only solipsism or schizophrenia,
neither of which can be used for examination of the outside world."
- Daniel Harper
==
Number of base pairs in a virus
polio: 7,741
influenza: 13,500
ebola: 19,000
smallpox: 185,000.
===
Scientists Plan to Rebuild Neanderthal Genome
Researchers at the Max Planck Institute for Evolutionary Biology in Leipzig,
Germany, plan to reconstruct the genome of Neanderthals, the archaic human
species that occupied Europe from 300,000 years ago until 30,000 years ago
until being displaced by modern humans.
The genome will initially be reconstructed using DNA extracted from
Neanderthal bones that are 45,000 years old, which were found in Croatia,
though bones from other sites may be analyzed later.
The project is a collaboration between Dr. Svante Paabo of the Max Planck
Institute for Evolutionary Anthropology in Leipzig, Germany, and 454 Life
Sciences, a Connecticut company that has developed a new method of sequencing,
or decoding, DNA.
The sequencing of Neanderthal DNA, long a forlorn hope, suddenly seems
possible because of a combination of analytic work on ancient DNA by Dr. Paabo
and a new kind of DNA sequencing machine developed by 454 Life Sciences.
Because the genome must be kept in constant repair and starts to break up
immediately after the death of the cell, the DNA in Neanderthal bones exists
in tiny fragments 100 or so units in length. As it happens, this is just the
length that works best with the 454 machine, which is also able to decode vast
amounts of DNA at low cost.
Recovery of the Neanderthal genome, in whole or in part, would be invaluable
for reconstructing many events in human prehistory and evolution. It would
help address such questions as whether Neanderthals and humans interbred,
whether the archaic humans had an articulate form of language, how the
Neanderthal brain was constructed, if they had light or dark skins, and the
total size of the Neanderthal population.
The project is still at an early stage but much groundwork has already been
laid. Most Neanderthal bones contain no Neanderthal DNA at all, but almost all
are heavily contaminated with the human DNA of the many people who handled the
bones. Dr. Paabo has developed stringent methods to address this contamination
problem.
Even with the DNA that is known to be ancient, some 95 percent of that in
Neanderthal bones belongs to ancient bacteria, said Michael Egholm, a vice
president of 454 Life Sciences. But these bacterial sequences can be
recognized and discarded, Dr. Egholm said.
Because Neanderthal DNA is so scarce, Dr. Paabo and the 454 researchers
developed their methods on ancient DNA from cave bears and mammoth.
Turning to Neanderthal bones, they have already recovered considerable amounts
of DNA sequence, which are derived from every chromosome in the Neanderthal
cell, as judged by matching the Neanderthal DNA to the human genome sequence
that was first fully decoded in 2003.
The first goal of the project will be to sequence three billion units of
Neanderthal DNA, corresponding to the full length of the Neanderthal genome.
This will require decoding 20 times as much DNA, because so much of the DNA in
the Neanderthal bones belongs to bacteria.
Genomes must usually be decoded several times over to get a complete and
accurate sequence, but the first three billion bases of Neanderthal should hit
all the essential differences, Dr. Egholm said.
The researchers hope is to recover the entire sequence of the Neanderthal
genome, but that will depend on which they can recover enough DNA. From
sampling so far, no particular gaps in the sequence are apparent. We are
hitting all the chromosomes and getting good coverage, Dr. Egholm said. If no
single specimen yields a full sequence, the genome might be recovered by
combining DNA from several individuals.
One of the most important results that researchers are hoping for is to
discover, from a three-way comparison between chimp, human and Neanderthal
DNA, which genes have made humans human. The chimp and human genomes differ at
just 1 percent of the sites on their DNA. At 1 percent, Neanderthals resemble
humans at 96 percent of the sites, to judge from the preliminary work, and
chimps at 4 percent. Analysis of the DNA at the sites at which humans differ
from the two other species will help understand the evolution of specifically
human traits and perhaps even aspects of cognitive function, Dr. Paabo said.
The degree of resemblance between humans and Neanderthals is fiercely debated
by archaeologists and even issues such as whether Neanderthals had language
have not been resolved.
Dr. Paabo believes that genetic analysis is the best hope of doing so. He has
paid particular attention to a gene known as FOXP2, which from its mutated
forms in people seems to be involved in several advanced aspects of language.
The human version of the gene differs at two sites from the chimp version.
Knowing whether the sequence of the Neanderthal gene is closer to chimps or
humans would help decide whether they had advanced speech like people or some
lesser form of communication, perhaps without syntax.
I suspect they had language in some form but perhaps not quite as we do it,
Dr. Paabo said. Asked if he had already had hit the FOXP2 gene in the
Neanderthal sequencing done so far, he said No, that would be just too lucky.
If the Neanderthal genome were fully recovered, it might in principle be
possible to bring the species back from extinction by inserting the
Neanderthal genome into a human egg and having volunteers bear Neanderthal
infants. There would, however, be great technical and ethical barriers to any
such venture.
==
there are thousands of taxinomic families. Above species in the taxinomic
tree is "genus". There are over 200 families of birds, 70 or so familes of
mammals, over 500 families of insects (including 125 families of just
beetles), and so on, not even mentioning the plant families.
==
Error catastrophe becomes likely for ss RNA at 100 nucleotides or
above. 15 bp ds is well below this, and ds should make it more stable.
Moreover, the spontaneous formation of RNA sequences is known to
occur in certain mineral environments.
==
Atomic-resolution structure of a ribozyme yields insights into RNA catalysis
and the origins of life
The solution came with the discovery 20 years ago that certain types of RNA
can act as enzymes, catalyzing reactions just as enzymes made of protein do.
This means, in principle, that a single type of molecule, RNA, might be able
to both encode information and replicate it. The idea that the first
self-replicating molecules in a pre-biotic primordial soup were composed of
RNA, known as the "RNA World" hypothesis, is one of the central tenets upon
which many theories of the origin of life are now based.
Research on the structure and function of RNA enzymes, or ribozymes, has been
one of the main activities in the Center for the Molecular Biology of RNA at
the University of California, Santa Cruz, as well as many other laboratories
throughout the world. In addition to offering glimpses into how life may have
originated, ribozymes are also being engineered in many academic and
industrial laboratories to be therapeutic agents for potential use in fighting
infectious and chronic diseases.
Scientists at UCSC's RNA Center have now obtained a near-atomic resolution
image of the three-dimensional shape of a very simple--and therefore
potentially understandable--ribozyme in which the atoms are uniquely arranged
and poised for catalysis in the context of an intricately twisted and folded
segment of RNA. The new findings are described in a paper by graduate student
Monika Martick and her adviser, William Scott, associate professor of
chemistry and biochemistry, in the July 27 issue of the journal Cell. The
paper will be available online on July 20.
Using the technique of macromolecular x-ray crystallography, Martick and Scott
were able to obtain a three-dimensional picture of the spatial arrangement of
the several thousand atoms that comprise the ribozyme, known as the hammerhead
ribozyme. The resulting color-coded structure was recently featured on the
cover of the abstract book for the annual meeting of the RNA Society held in
Seattle in early June.
"The structure illustrates unambiguously how functional groups of the RNA
mediate acid-base chemical catalysis, permitting us to suggest that acid-base
chemistry is so fundamental to enzyme catalysis that it predates the origin of
protein enzymes," Scott said.
For Scott, these results are the culmination of 19 years of research on the
structure of the hammerhead ribozyme. He started work on the project as a
graduate student at UC Berkeley in 1987, a few months after the ribozyme was
discovered. Later, as a postdoctoral researcher at the MRC Laboratory of
Molecular Biology in Cambridge, England, he achieved his first breakthrough.
Scott subsequently built an internationally-recognized research team at UCSC
that has performed static and time-resolved experiments resulting in the first
crystallographic time-lapse "movie" of ribozyme catalysis. His group has also
elucidated structures of other RNAs, including the recent structure of a
highly conserved motif from the SARS virus genome.
Scott's structural observations of the hammerhead ribozyme, however, could not
explain a growing number of biochemical experimental results. The hammerhead
ribozyme has been the subject of intensive investigations by researchers
around the world, and Scott found his most cherished accomplishments called
into question.
"In 2002, I had two very lucky breaks," he said. "The first was that I learned
of a new form of this ribozyme that was 1,000 times faster than the most widely
studied form. The second was that an exceptionally talented graduate student,
Monika Martick, joined my research group."
The faster form includes an extended sequence of RNA building blocks that
researchers had previously neglected to study. Martick and Scott set to work
on this newly discovered form of the ribozyme, achieving a breakthrough in
March after four years of experiments.
==
There are fish that live now that can move on land Foridas walking catfish and
Texas grenel fish both have a crude air bladder they use for lungs they can
move over land when their water source dries up or burrow in to the mud and
hibernate
===
a SMALL list of transitional fossils;Amphibians to Amniotes Proterogyrinus;
Limnoscelis Tseajaia Solenodonsaurus Hylonomus Paleothyris Synapsid reptiles
to mammals; Protoclepsydrops Clepsydrops Dimetrodon Procynosuchus Diapsid
reptiles to birds;Compsognathus Protoavis Archeopteryx Changchengornis
Confuciusornis Ichthyornis evolution of whales Pakicetus Ambulocetus
Artiocetus Dorudon Basilosaurus Eurhinodelphis Mammalodon Evolution of the
horse; Hyracotherium Mesohippus Parahippus Merychippus Pliohippus
==
Amphibians developed with the pharyngeal slits/gills, a dorsal nerve cord, a
notochord, and a tail at different stages of their life. Though early
tetrapods (which appeared 390 million years ago in the Devonian period) are
often referred to as "amphibians", the first true amphibians (subclass
Temnospondyli)began to appear was during the early Carboniferous
period.(Permian)

Triadobatrachus; is about 250 million years old, and had not yet evolved the
full combination of features associated with frogs. TH recepters 'are'
frog-like, being broad with large eye sockets. The fossil has other features
seperating it from modern frogs. The ilium, a long body with more vertebrae,
and separate vertebrae in its tail, as modern frogs, the tail vertebrae are
fused, the urostyle. The tibia and fibula bones are unfused and separate. The
Triadobatrachus is clearly an intermediate species.

The horse is complete; recognisable horse-like anatomy are found in the
Eocene epoch. Hyracotherium, an animal approximately the size of a fox with a
short head, 44 teeth a short neck, a springy, arched back, low to the ground.
Its limbs were relatively long, already showing the beginnings of adaptations
for running. It is the earliest 'transitional' fossil related to the horse.
Horses are ungulates of the order Perissodactyla, They arose less than 10
million years after the dinosaurs became extinct. About 20 million years ago
even-toed "more horse like' ungulates became dominant, relatives of the modern
horse.
The forelimbs had developed five toes out of which only four were equipped
with a small hoof. the fifth large toethumb was off the ground. During the
Eocene, the Hyracotheria branched out into various types resembling the fox in
size. Thousands of complete, fossilized skeletons of these animals have been
found in the Eocene layers of North America. Similar fossils of horses have
also been discovered in Europe. It is one of thousands of trasitional fossils.

Modern hyraxes are members of the family
Procaviidae-Hyracoidea They are found in Africa and the Middle East. In the
miocene hyraxes were more diverse and widespread. The order first appears in
the fossil record over 40 million years ago, for millions of years hyraxes
were terrestrial herbivore in Africa

Modern coral reefs aren't found until the Cretaceous period.

Most modern fish belong to a group called the Teleost fishes. They dominate
all ecological regions in the ocean, in freshwater, everywhere. But
they don't even appear in the fossil record until the Mesozoic,
well after the appearance of amphibians and reptiles.

The first land plants appear in the Ordovician, significantly preceding the
first amphibians, late [[Devonian, and greatly preceding the first
reptiles in the Carboniferous.
=====
TAXON
-----
STEGOSAURUS
--
Kingdom Animalia
Phylum Chordata
Class Archosauria (in some systems, Reptilia)
Order Ornithischia
Family Stegosauridae
Genus Stegosaurus
Species stenops

===
Giardia and Trichomonas are eukaryotes without standard mitochondria
but contain mitochondrial-type -proteobacteriumderived ironsulfur
cluster (ISC) assembly proteins, located to mitosomes in Giardia and
hydrogenosomes in Trichomonas. Although these data suggest a single
common endosymbiotic ancestry for mitochondria, mitosomes, and
hydrogenosomes, separate origins are still being proposed. Here, we
present a bioinformatic analysis of Isd11, a recently described
essential component of the mitochondrial ISC assembly pathway. Isd11
is unique to eukaryotes but functions closely with the -
proteobacteriumderived cysteine desulfurase IscS. We demonstrate
the presence of homologues of Isd11 in all 5 eukaryotic supergroups
sampled, including hydrogenosomal and mitosomal lineages. The
eukaryotic invention of Isd11 as a functional partner to IscS
directly implies a single shared -proteobacterial endosymbiotic
ancestry for all eukaryotes. This pinpoints the -proteobacterial
endosymbiosis to before the last common ancestor of all eukaryotes
without ambiguity.
===
http://wiki.cotch.net/index.php/Main_Page
==
Charles Darwin became a Christian on his Deathbed,
renouncing his theory.
LL: It would be strange if it were true, but it isn't. You obviously only
listen to what your church tells you and never think to check out the facts.
There is a story that Charles Darwin (1809-1882), English naturalist and
developer of the theories of evolution through natural and sexual selection,
recanted his life's work and agnosticism and accepted Christianity on his
deathbed. It has been circulating through evangelical publications and
broadcasts
for many years. The story originated with Lady Hope (a.k.a. Elizabeth Reid
Cotton, widow of Admiral of the Fleet Sir James Hope), an evangelist in
Darwin's
neighborhood of Downe, England. She said in a 1915 speech to a Moody
evangelical school in East Northfield, Ma., that on his deathbed Darwin had
been reading the Epistle to the Hebrews. Supposedly, he wished for singing and
worship at his home, regretted that his evolutionary "speculations"
were taken so
seriously and had caused such evil, and that he accepted the Christian scheme
of "salvation." The story was printed in the Boston Watchman Examiner
and has been in circulation ever since.
The evidence shows that the story is not true. Lady Hope was not present at
the deathbed of Darwin. The multiple independent accounts of his death,
written by those who were there, make no mention of it. His children who were
there at his death wrote articles and letters that specifically refuted the
recantation and conversion story. Lady Hope did show such detailed
knowledge of Darwin's home and estate that she must have visited Darwin at
some time late in his life, though not at his deathbed. Darwin himself was
disturbed with the misuses "Social Darwinism" made of his theories. He thought
that Christianity was good for common people, though not for himself and other
educated men. Darwin was revising his theories in the latter part of his life,
to take new information into account, though he did not doubt that evolution
had occurred, only how it had happened. Lady Hope probably heard all of this
in a visit to Darwin late in his life, and conflated it imaginatively into a
deathbed recantation!
==
http://brad.com/christiandebate vestigal organs
==
An important question is how can a gene controlling coat color cause death in
an organism? Possibly in a single dose the allele causes a yellowing of the
coat, but when expressed in two doses, the gene product kills the animal. Thus,
this gene actually has an effect on two phenotypes.
Pleiotropic gene - a gene that affects more than one phenotype
In this example the gene that causes yellowing of the coat also affects
viability and is termed a pleiotropic gene.
==
For one type of orchid in
China, procreating is a lonely affair. Rather than depending on
insects or even the wind for pollination, scientists have discovered
that the orchid Holcoglossum amesianum actually fertilizes itself,
according to a report in this week's Nature.
The orchid defies gravity to twist the male part of its flower into
the necessary shape to fertilize the female one, a team led by
LaiQuang Huang of Tsinghua University found.
The plant does so without the help of sticky fluids or other methods
used by self-pollinating plants to ensure that the pollen reaches
the egg, LaiQuang reported. This makes it a new method of
pollination, he said.
The team studied more than 1,900 flowers of this species, which
grows on tree trunks in China's Yunnan province and flowers during
the dry, windless months of February to April.
The orchid produces no scent or nectar, and the researchers did not
see a single instance of pollination by an insect or by wind.
Instead, the pollen-bearing anther uncovers itself and rotates into
a suitable position to insert into the stigma cavity, where
fertilization takes place.
This sexual relationship is so exclusive that flowers do not even
transfer pollen to other flowers on the same plant, researchers found.
==
The limbs of tetrapods did a great deal
of their evolving while we were still in the water, with the Titaalik
roseae being one of the most recently discovered fish in that
sequence. In the water, you don't have to worry about supporting
yourself as much, but increased control over your "fins" helps. In
the shallows, pushing through brush, more is required, although not as
much as walking on land.
The evolution of the limbs ( or circulatory system -- as in the
starfish, or blood-clotting mechanism, etc.) was a gradual process,
but it only needed to be a gradual process. Moreover, and this is a
point morpheological development during the growth of the organism is
coordinated, but this coordination during morpheological development
also means that it is only a few key variables which have to change
for there to be coordinated evolution. This is why both Lenny and I
emphasized regulatory genes.
The big trick is getting to multicellularity with specialized cells,
but even that isn't either/or. A number of single-celled organisms
join together and undergo specialization when resources become scarce.
One the best known cases is the social amoeba.
==
IAP STATEMENT ON THE TEACHING OF EVOLUTION
We, the undersigned Academies of Sciences, have learned that in
various parts of the world, within science courses taught in certain
public systems of education, scientific evidence, data, and testable
theories about the origins and evolution of life on Earth are being
concealed, denied, or confused with theories not testable by science.
We urge decision makers, teachers, and parents to educate all children
about the methods and discoveries of science and to foster an
understanding of the science of nature. Knowledge of the natural world
in which they live empowers people to meet human needs and protect the
planet.
We agree that the following evidence-based facts about the origins and
evolution of the Earth and of life on this planet have been
established by numerous observations and independently derived
experimental results from a multitude of scientific disciplines. Even
if there are still many open questions about the precise details of
evolutionary change, scientific evidence has never contradicted these
results:
1. In a universe that has evolved towards its present configuration
for some 11 to 15 billion years, our Earth formed approximately 4.5
billion years ago.
2. Since its formation, the Earth - its geology and its environments -
has changed under the effect of numerous physical and chemical forces
and continues to do so.
3. Life appeared on Earth at least 2.5 billion years ago. The
evolution, soon after, of photosynthetic organisms enabled, from at
least 2 billion years ago, the slow transformation of the atmosphere
to one containing substantial quantities of oxygen. In addition to the
release of the oxygen that we breathe, the process of photosynthesis
is the ultimate source of fixed energy and food upon which human life
on the planet depends.
4. Since its first appearance on Earth, life has taken many forms, all
of which continue to evolve, in ways which palaeontology and the
modern biological and biochemical sciences are describing and
independently confirming with increasing precision. Commonalities in
the structure of the genetic code of all organisms living today,
including humans, clearly indicate their common primordial origin.
We also subscribe to the following statement regarding the nature of
science in relation to the teaching of evolution and, more generally,
of any field of scientific knowledge : Scientific knowledge derives
from a mode of inquiry into the nature of the universe that has been
successful and of great consequence. Science focuses on (i) observing
the natural world and (ii) formulating testable and refutable
hypotheses to derive deeper explanations for observable phenomena.
When evidence is sufficiently compelling, scientific theories are
developed that account for and explain that evidence, and predict the
likely structure or process of still unobserved phenomena.
Human understanding of value and purpose are outside of natural
science's scope. However, a number of component